Go to Top Go to Bottom
Liu, Zheng, Zhang, and Lu: Microarray Analysis of Genes Involved with Shell Strength in Layer Shell Gland at the Early Stage of Active Calcification

Abstract

The objective of this study was to get a comprehensive understanding of how genes in chicken shell gland modulate eggshell strength at the early stage of active calcification. Four 32-week old of purebred Xianju hens with consistent high or low shell breakage strength were grouped into two pairs. Using Affymetrix Chicken Array, a whole-transcriptome analysis was performed on hen’s shell gland at 9 h post oviposition. Gene ontology enrichment analysis for differentially expressed (DE) transcripts was performed using the web-based GOEAST, and the validation of DE-transcripts was tested by qRT-PCR. 1,195 DE-transcripts, corresponding to 941 unique genes were identified in hens with strong eggshell compared to weak shell hens. According to gene ontology annotations, there are 77 DE-transcripts encoding ion transporters and secreted extracellular matrix proteins, and at least 26 DE-transcripts related to carbohydrate metabolism or post-translation glycosylation modification; furthermore, there are 88 signaling DE-transcripts. GO term enrichment analysis suggests that some DE-transcripts mediate reproductive hormones or neurotransmitters to affect eggshell quality through a complex suite of biophysical processes. These results reveal some candidate genes involved with eggshell strength at the early stage of active calcification which may facilitate our understanding of regulating mechanisms of eggshell quality.

INTRODUCTION

The chicken eggshell is a porous bioceramic container which protects the egg against physical damage and microbial contamination. Avian eggshell consists of the innermost bilayered membranes, a calcified layer composed of a mamillary and pallisade layer, and the outermost cuticle. The calcified layer consists of both inorganic minerals and extracellular matrix. It is well known that the shell mineral amount (thickness or density) is the main factor contributing to the mechanical properties of the eggshell (Ahmed et al., 2005). However, the organic matrix, although its content in the calcified layer is only 2 to 3.5%, is of great importance to the deposition of bicarbonate and calcium ions, and to eggshell strength by controlling calcite crystal nucleation, growth, size and orientation (Greenfield et al., 1984).
The organic matrix in the calcified layer is comprised of a complex suite of components. In the acid soluble part of chicken eggshell matrix, 520 proteins have been identified (Mann et al., 2006), including several abundant proteins such as ovalbumin (Hincke, 1995), ovotransferrin (Gautron et al., 2001b), lysozyme (Hincke et al., 2000), osteopontin (Pines et al., 1995), sialoprotein (Solomon, 1999), clusterin (Mann et al., 2003), ovocleidin-17 (Hincke et al., 1995), ovocleidin-23 (Mann, 1999), ovocleidin-116 (Carrino et al., 1997), ovocalyxin-32 (Gautron et al., 2001a) and ovocalyxin-36 (Gautron et al., 2007). Many of the above components have been reported to undergo various post-translation modifications,which allow them to be effective chelators for interacting with the inorganic materials (Veis, 1989; Reyes-Grajeda et al., 2004; Mann et al., 2007), or to mediate protein–protein interactions to facilitate the assembly of the organic matrix (Lakshminarayanan et al., 2002; Ney et al., 2006).
It has been demonstrated that some genes in hen oviduct are associated with eggshell formation, whose expression is dependent on mechanical strain (Pines et al., 1995; Lavelin et al., 1998; Lavelin et al., 2002). It is proposed that some genes may function as crucial modulators for eggshell quality through regulating signal transduction, ion transportation, expression or modification of organic components, and many other processes. However, despite the importance of eggshell strength in the poultry industry, very few transcriptome-wide studies regarding this trait have been published to date (Yang et al., 2007; Dunn et al., 2009; Jonchère et al., 2010).
It is well documented that various parts of the avian eggshell are formed in specific regions of the oviduct as the egg passes through them. During the laying sequence, about 4 h after previous oviposition, the next egg arrives at and will take about 1h to pass through the white isthmus, in which the bilayered shell membranes are built around the egg. Then the egg enters the initial part of the shell gland, the red isthmus (tubular shell gland), and stays there for about 5 h to form mammillary knobs (Reyes-Grajeda et al., 2004). Finally the egg reaches the uterus (the main part of shell gland) and stays for an additional 15 h to form the palisade layer (Creger et al., 1976). It is known that the mamillary layer is the base of calcite crystal nucleation and crystal growth, and the palisade layer is the main part of the calcified shell, both of which affect global eggshell quality (Reyes-Grajeda et al., 2004; Jonchère et al., 2010).
In this study, we focused on the shell gland (uterus tissue near the red isthmus) at about 9 h post oviposition (corresponding to the early stage of active calcification, or to the transition stage from mammillary knob formation to construction of the palisade layer), and identified differentially expressed genes (DE-genes) in the layers with high shell strength compared to those with weak eggshell. Our results provide insight into the candidate genes involved in the mamillary layer formation and calcification that is crucial to the mechanical properties of avian eggshells.

MATERIALS AND METHODS

Animal treatments

Ninety purebred Xianju hens (a widely-bred Chinese indigenous chicken breed) of 28 weeks old were individually housed in laying cages. Birds were maintained under a cycle of 16 h light and 8 h dark. All birds were fed ad libitum with water and a mash layer diet (165 g protein, 35 g Ca, 11.29 MJ ME/kg, as recommended by NRC of China, 2004).
After 10 d of adaptation for hens, the oviposition time of each egg was initiated to be observed and recorded, then egg weight and shape index (length/width) were measured immediately. Following strength testing, the egg content was discarded and the shell was washed, dried at room temperature and weighed. Shell thickness without membranes was measured with a digital micrometer. Shell index (g/100 cm2) (Sauveur, 1988) was calculated as I = (C/S)×100, in which C is the weight of shell with membranes, S is the shell surface (cm2) with S = 4.68×P2/3 where P = egg weight (g). All above measurements were consecutively carried out daily for 16 d.
Finally, 2 groups of 2 hens with consistent high or low shell breakage strength were found. The differences between the eggshell properties of the selected 4 hens were analyzed by One-way ANOVA variance analysis in SPSS statistic software.
The four hens of interest were humanely sacrificed about 9 h after the previous oviposition. It is of note that all of the sacrificed hens had eggs in their uteruses (Figure 1A). The fat was removed from the uterus tissues near red isthmus and the tissues were then frozen in liquid nitrogen immediately and stored at −80°C. The animal treatments were approved by the Commission for Animal Welfare of Zhejiang A&F University.

Measurement of eggshell strength

After egg weight and shape index measurements, the uncracked fresh eggs were individually placed lengthways with its blunt end upward in the FHK testing machine (Fujihara Co., Tokyo, Japan), and the vertical pressure was increasingly loaded upon the eggshell until the eggshell cracked and the eggshell strength was recorded as the maximum load (kgf).

RNA preparation

About 500 mg of the tissue of the uterus near red isthmus, including the mucosa, muscularis and outer serosa was powdered under liquid nitrogen. The total RNA was extracted using the RNAiso Plus Mini Kit (TaKaRa, Dalian, P.R. China) according to the manufacturer’s instructions. RNA concentration and purity were measured by a NanoDrop spectrophotometer (NanoDrop® ND-1000, NanoDrop Technologies, DE).

Microarray hybridization and image acquisition

Microarray analysis was performed by the Bioassay Laboratory of CapitalBio Corporation (CapitalBio Co., Beijing, China). Briefly, the RNA integrity was firstly assessed using a Bioanalyzer (Agilent Technologies, Cheshire, UK), then 2 μg of total RNA was used for reverse transcription and biotin-labeled cRNA synthesis according to the manufactures’ instructions, and finally subjected to microarray hybridization. The Affymetrix GeneChip® Chicken Genome Array (Affymetrix, Santa Clara, CA, USA) was used in this study, which contains 38,535 probesets corresponding to >28,000 chicken genes. Following 16 h of hybridization, the arrays were immediately washed, stained and scanned using Affymetrix® GeneChip® scanner 3000 (Affymetrix, Santa Clara, CA, USA), and the image files were processed into raw CEL intensity files using GeneChip Operating Software (GCOS version 1.2).

Pre-processing and normalization of microarray data

The raw intensity files generated by GCOS were imported and processed by R with Bioconductor packages. The total RNA quality was firstly verified statistically again by plotting the 5′-3′ hybridization signal trends across all target transcripts. Then the microarray intensity was processed into transcript expression by the Affymetrix MAS5.0 method implemented in the R package, a procedure including background normalization, PM/MM probe correction, expression summarization and constant normalization on probeset level.

Identification of DE-transcripts

To identify DE-transcripts, the 4 array samples were first grouped into two pairs of high vs. low eggshell strength according to eggshell property differences of the hens (see results). According to Cheuk and Cheng (2011), Affymetrix platform is relatively precise and sensitive in detecting signals, the DE-transcripts were identified as those with fold-change >= 2 in either of the two pairs of comparison and a statistical significant difference between high strength and low strength samples (p<0.05, Welch t-test). It is of note that the log-odds values (Lods) of expression fold-change were used in the analysis; therefore, the DE-transcripts always have an absolute Lods value no less than 1 (|Lods|≥1).

Gene ontology enrichment analysis

Gene ontology enrichment analysis for DE-transcripts was performed using the web-based GOEAST (Zheng and Wang, 2008) Affymetrix analysis tool, with FDR cut-off of 0.05 using Yekutieli’s FDR adjustment method.

Validation of differential expression by qRT-PCR experiments

Twenty-one DE-transcripts, with a fold-change ranging from low to high, were selected for further validation with qRT-PCR experiments; and all two groups of microarray samples were tested. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal reference in all the PCR experiments. The primer sequences for qRT-PCR experiments can be found in Table 1.
To begin, total RNA was individually reverse transcribed with the SYBR® PrimeScript RT-PCR kit II (TaKaRa, Dalian, China) according to the manufacturer’s instructions. Then above RT-PCR kit was further used for fluorescence detection on an ABI Prism 7500 Sequence Detection System (Applied Biosystems, USA). All samples were analyzed in triplicates.
Dissociation curve analysis was conducted to ensure that a single PCR product with appropriate size was amplified in each reaction. On the other hand, the examination of PCR efficiency was performed based on LinRegPCR program (12.X) (Ramakers et al., 2003; Ruijter et al., 2009) to ensure internal and target transcript primers were amplified with similar efficiency.
The differential expression levels (Log2 units) were calculated using the equation Log2 units (high versus low) = −ΔΔCt, where ΔΔCt = (Ctth-Ctih)-(Cttl-Ctil). Ct is the threshold cycle number when the amount of amplified product reaches a stable threshold. Ctth and Ctih represented the Ct of target transcript and internal reference transcript of “high eggshell strength sample”, respectively. Correspondingly, Cttl and Ctil represented the Ct of target transcript and inner-reference transcript of “low eggshell strength sample”, respectively.

RESULTS

Eggshell quality of hens under study

Among 90 tested hens, only 6 of them laid eggs at a similar laying rate with consistent high eggshell strength (defined as ≥4.5 kgf) or low strength (defined as ≤3.5 kgf). Two of these 6 hens were sacrificed at about 11.5 to 12 h post oviposition, but the eggshells collected from the shell glands showed more calcification extent than expected (Figure 1A and 1B). To focus on the initial stage of active calcification, we decided to use the uterus tissues near red isthmus from the remaining 4 hens, namely #19, #35, #40 and #80, at about 9 hr post oviposition. The eggs and eggshells harvested from these 4 hens at the moment of tissue sampling are shown in Figure 1A and Figure 1B. The eggshell breaking strength is also shown in Table 2 for these 4 hens, with consistent high (#19 and #40) or low (#35 and #80) eggshell quality.
To eggs from #19 and #35 hens, the differences of both shell strength and shell weight were very significant (p<0.01, t-test), but there was no significant difference (p>0.05) for other eggshell quality metrics, such as shell thickness or shell index (Table 2). On the other hand, the differences of all of above eggshell metrics between eggs from #40 and #80 hens were very significant (p<0.01) (Table 2). To get rigorous microarray data, therefore, we grouped the #19 with #35 hens due to the similarity of some of eggshell mechanical properties of the paired individuals; while #40 and #80 hens were also grouped as another pair.

Differentially expressed transcripts

The expression level of all probesets in 4 array samples were analyzed, and 1,195 DE-transcripts between uterus samples with high shell strength and low shell strength were identified. These DE-transcripts correspond to 941 unique genes. Among them, 407 genes were up-regulated in high strength samples comparing to low strength samples, and the other 534 genes were down-regulated. The expression profile of all 1,195 DE-transcripts is shown in the heatmap in Figure 2. As shown in the heatmap, samples #19 with #40 and #35 with #80 were grouped as clusters among different samples, consistent with the similarity of their eggshell quality.
According to gene ontology annotations, the DE-transcripts are involved in a variety of biological processes. The most prominent DE-transcripts were found related to the following processes: signal transduction (88 DE-transcripts), ion transport and extracellular matrix organization (77 DE-transcripts), carbohydrate metabolism and protein modification (26 DE-transcripts) (Table 3).
Furthermore, avian calcified eggshell is a biomaterial composed of calcium salt and special ECM. The ECM is mainly comprised of collagens, glycoproteins and proteoglycans. Among the DE-transcripts, COL8A2, COL12A1, COL13A1, LOC424798, LAMA2, LAMA4, LAMB4, and LAMC1 may be related to extracellular matrix formation; while CHST3, GALNTL1, NDST4, LARGE, POFUT2, RCJMB04_28l23, and MAN1A2 are all localized in the endoplasmic reticulum or Golgi apparatus, and likely mediate the processes of carbohydrate metabolism, or posttranslation glycosylation modification.

Gene ontology (GO) term enrichment of DE-transcripts

It is of note that although many DE-transcripts were found related to various biological processes according to their ontology annotations, they are not necessarily correlated to the eggshell quality, due to random noise or other non-specific confounding factors commonly existing in microarray or other high-throughput experiments. Therefore, using web-based GOEAST (Zheng and Wang, 2008) we further identified significantly enriched GO terms among all the DE-transcripts. According to biology processes or molecular functions, the enriched GO terms can be roughly classified into several groups (Tables 4 and 5).
A group of processes are involved in reproductive hormone regulation, which contain Somatotropin secreting cell differentiation (GO:0060126), adenohypophysis development (GO:0021984), and response to estradiol stimulus (GO:0032355) (Table 4).
As shown in Table 4 and Table 5, many DE-transcripts are involved in signal transduction, such as GO terms purinergic nucleotide receptor activity (GO:0001614), nucleotide receptor activity (GO:0016502), purinergic receptor activity (GO:0035586), transmembrane signaling receptor activity (GO:0004888), and negative regulation of BMP signaling pathway (GO:0030514). Among them, GO:0004888 dominantly contains 33 transcripts encoding signal receptors, and these receptors could be further classified into several subgroups: OXTR, LOC431251 and SSTR3 belong to reproductive hormone receptors; CHRM2, ADRA2B, P2RX4, P2RY2, EDNRB2, GABRB2, GABRG2, LOC428961 and NPFFR2 function as receptors mediating neurotransmitters or neuropeptide; GRIN2B and GRIN3A could modulate the efficiency of synaptic transmission; NTRK1 and NTRK2 belong to the receptor tyrosine kinase (RTK) family, and are involved with neurotrophin (GO:0005030 - neurotrophin receptor activity; and GO:0043121 - neurotrophin binding) (Table 5).
Besides various enriched molecular function shown above, many biophysical processes are also found to be enriched among the DE-transcripts, including a series of processes and subgroups (Tables 4 and 5). GO:0003951 (NAD+ kinase activity) modulate the metabolism or redox in cell (Table 5). Enrichment of GO:0009409 (response to cold) may reflect the fact the rearing condition of experimental hens was in the winter at room temperature about 2 to 10°C. GO:0046209 (nitric oxide metabolic process) may regulate vascular or smooth muscle relaxation or other functions. GO:0002028 is involved in ion transportation. While the subgroup processes of muscular development and activity include skeletal muscle fiber development (enrichments of GO:0048741, GO:0048747 and GO:0055002) and striated muscle contraction regulation (enrichments of GO:0055117 and GO:0006942). It is of note that there is almost no striated muscle in avian uterus except smooth muscle. However, the chicken genome project was completed in 2004, and the functional gene database of G. gallus remains incomplete, some ontology annotations of DE-genes may refer to mammalian homologs, which may account for our results. The genes related to muscular cell contraction are likely to modulate the mobility of uterus to facilitate egg rotation and calcification (Johnson, 1986; Jonchère et al., 2010). Similarly, there is no digestion process in the uterus, three genes in GO:0007586 (digestion process), PGA5 (an aspartic acid protease, which is involved in ovulation (Peluffo et al., 2011)), PRSS2 and LOC396365 (preprogastrin), are likely to promote the maturation of secretary extracellular proteins or regulate the secretion of uterus glands and mobility of uterus.
The final group of reproductive biophysical processes also includes several subgroups of processes (Table 4). Epithelial tube morphogenesis (GO:0060562) may regulate the development of uterus glands (tubular epithelial glands). Oocyte development subgroup contains oocyte differentiation (GO:0009994) and oocyte development (GO:0048599). Female pregnancy subgroup contains enrichments of GO:0060135, GO:0060745, GO:0060748, GO:0060444 and GO:0060603.
Overall, laying is an avian reproductive behavior, and eggshell calcification is regulated by relative reproductive hormones and neurotransmitters, which may finally affect eggshell quality through a complex suite of biophysical reactions.

Confirmation of DE-transcripts by qRT-PCR

21 DE-transcripts (9 up-regulated and 12 down-regulated) were chosen for validation using qRT-RCR experiments, and the four microarray samples were tested in pairs for #19 vs #35 and #40 vs #80, respectively. As shown in Figure 3, 16 out of the 21 tested transcripts (76%) were confirmed by qRT-PCR experiments, though the absolute fold-change values are slightly different. The remaining transcripts, CRYBB1, EXOC6B, LOC416916, MAN1A2 and CHST3, showed inconsistent differential expression between qRT-PCR and microarray experiments.
GAPDH, CHST3, GALNTL1, NDST4, LARGE, SP1, RHOBTB2, and WDR72 were selected to examine the PCR efficiency. The results showed the PCR efficiency of these genes ranged from 86.8% to 94.2%, and the PCR efficiency of inner reference (GAPDH) and other genes seemed nearly similar.

DISCUSSION

Laying is regarded as avian reproductive behavior, which is regulated by reproductive hormones and neurotransmitters. The chicken oviduct has been extensively used as a model to study hormonal induction of protein synthesis (Khuong and Jeong. 2011). Under the control of steroid hormones or neurotransmitters, the tubular gland epithelial cells synthesize and secrete a great variety of proteins to form egg white and eggshell when egg passes through the oviduct (Mann et al., 2006). In this paper, 1,195 DE-transcripts have been identified to be related with eggshell strength. GOEAST analysis further identify some significantly enriched GO terms, and the enriched GO terms suggest that some DE-transcripts mediate reproductive hormones or neurotransmitters to affect eggshell quality (Tables 4 and 5).
Both terms GO:0060126 and GO:0021984 are involved in reproductive hormone regulation, and share two genes, OTX2 and WNT4.
Otx2 is a paired-like homeodomain transcription factor, which can mediate GnRH (gonadotropin releasing hormone) signaling (Kelley et al., 2000). Functional studies revealed that Otx2 is required as early as gastrulation for neural induction, and even for brain development (Rhinn et al., 1998). However, Otx2 is also of importance for neurogenesis and cellular proliferation in multiple other tissues (Layman et al., 2011).
As a member of the WNT family, Wnt4 is a secreted glycoprotein signaling molecule and involved in paracrine signaling (Diaz et al., 2011). Wnt4 is critical for female sex determination and differentiation (Chen et al., 2011). In the female, Wnt4 is positively involved in ovarian development; while in the male mutated WNT4 will result in aberrant testis development (Diaz et al., 2011; Barrionuevo et al., 2012). On the other hand, Wnt4 is also potent to regulate the development of the female reproductive tract (Franco et al., 2011). Furthermore, WNT4 is expressed postnatally in ovarian follicles and corpora lutea, and its expression increases in response to gonadotropin (Hsieh et al., 2002). Wnt4 mediates follicle development and fertility by regulating the expression of genes involved in steroidogenesis, prostaglandin biosynthesis, tissue remodeling, and angiogenesis (Hsieh et al., 2002; Boyer et al., 2010). Moreover, excluding its reproductive contributions, WNT4 is also tightly associated with bone strength (Zmuda et al., 2011).
Our results also show that some DE-transcripts are involved in signal transduction (Tables 4 and 5), among which, NTRK1, NTRK2, P2RX4, and P2RY2 are overlapped in multiple enriched GO terms (Table 5).
Ntrk1, also named TrkA, and Ntrk2 TrkB, are two members of the neurotrophic tyrosine kinase receptor (NTKR) family. These kinases are membrane-bound receptors mediating various functions of neurotrophins, such as cell survival, migration, outgrowth of axons and dendrites, synaptogenesis, remodeling of synapses, and synaptic transmission (Ohira1 and Hayashi, 2009). So far, several neurotrophins have been well studied, such as nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin 3 (NT-3), and NT-4/5. NTKRs are high affinity receptors of neurotrophins. TrkA mediates the biological response of NGF, while BDNF and NT-4/5 are the preferred ligands for TrkB (Ohira1 and Hayashi, 2009). Additionally, NTKRs also play roles in some biomaterials. NT-4 may modulate proliferation and differentiation of the dental epithelium and promote production of the enamel matrix via the TrkB-MAPK pathway (Yoshizaki et al., 2008).
Both P2RX4 and P2RY2 are purinergic receptors. Purinergic receptors are subdivided into metabotropic P2Y receptors and ionotropic P2X receptors. P2Y receptors are coupled to G-protein and trigger inositol 1,4,5-triphosphate (IP3)-induced intracellular Ca2+ release following activation of phospholipase C, while P2X receptors are ligand-gated ion channels. P2RX4 will be discussed later, while P2RY2 performs a dominant role in calcium signaling during osteoblast differentiation (Nishii et al., 2009). It is known that extracellular ATP, UTP, and PPi can strongly block the mineralization of matrix nodules, while this potent inhibition of bone formation is mediated by P2RY2 (Orriss et al., 2007). Furthermore, P2RY2 is also involved in inhibition of intercellular communication between osteoblasts (Hoebertz et al., 2003).
At present, there are at least three cDNA microarray studies globally investigating the gene expression in chicken shell gland (Yang et al., 2007; Dunn et al., 2009; Jonchère et al., 2010), but the overlap among the DE-genes from these studies is not plentiful. Different animals, tissue samples or treatment methods may partially account for this problem.
Yang et al. (2007) harvested uterus tissues at 2 h post oviposition, and screened out 34 known genes in the shell glands between hens with low and high egg productive rates. This study and our data share a single gene CALD1 (caldesmon 1) (Figure 4). CALD1 is a ubiquitous actin and calmodulin binding protein, and functions as a substrate for mitogen-activated protein kinase (Childs et al., 1992) or as serine and threonine kinases (Sutherland et al., 1994).
Dunn et al. (2009) identified 266 DE-genes in shell glands from 25-week old mature hens comparing to 12-week old juveniles from high and low bone quality lines, respectively. The tissues sampled when eggs passed through the oviducts but not in shell glands. Three DEgenes are also found in our data: NADK (NAD kinase), LOC422993 (Similar to interferon-induced membrane protein Leu-13/9–27), and LAMP3 (lysosomal-associated membrane protein 3) (Figure 4), suggesting potential crucial function of these genes in not only early stage of eggshell calcification but also other stages of eggshell formation.
Jonchère et al. (2010) used the 40-week old hens at 18 h post oviposition (corresponding to the rapid phase of calcification), and identified 469 DE-known genes in uterus versus both white isthmus, and magnum. There are 7 genes consistently identified in their study and our data, such as P2RX4 (purinergic receptor P2X, ligand-gated ion channel, 4), FSTL1 (follistatin-like 1), TUBGCP4 (Tubulin, gamma complex associated protein 4), WDR77 (WD repeat domain 77), RCJMB04_6g16 (microtubule-associated protein 1 light chain 3 beta), PWP1 (PWP1 homolog in S. cerevisiae) and SGK1 (serum/glucocorticoid regulated kinase 1) (Figure 4).
On the other hand, three additional DE-genes in our data were previously found in the acid soluble part of chicken eggshell organic matrix (Mann et al., 2006). These three genes, FSTL1 (follistatin-like 1), CAMK2D (calcium/calmodulin-dependent protein kinase (CaM kinase) II delta) and KRT75 (keratin 75) (Figure 4), could reflect potential interaction of eggshell calcification and organic matrix formation.
Among these overlapping DE-genes, both P2RX4 (Jonchère et al., 2010) and NADK (Yang et al., 2007) are also present in our enriched GO terms (Tables 4 and 5), and FSTL1 (Mann et al., 2006; Jonchère et al., 2010) occurs in more than three relative studies.
P2RX4 is one member of the P2X receptors (P2RX). P2RX are ionotropic ATP-gated ion channels conducting Ca2+ inflow (Fodor et al., 2009), with high capability of Ca2+ permeabilities corresponding to at least 100-fold those of Na+ (Burnashev, 1998). In chondrogenic mesenchymal cells, P2X4 receptors could conduct Ca2+ inflow to elevate intracellular Ca2+ levels, and finally promoting extracellular matrix production (Fodor et al., 2009). Eggshell calcification requires considerable ion transportation, especially Ca2+, and various extracellular matrix synthesis and secretion, whether and how P2RX4 channels regulate these processes requires further studies.
NAD kinases (NADKs) are a family of enzymes transferring a phosphate group from ATP to NAD to generate and maintain the cellular NADP pool (Pollak et al., 2007). It is reported, that during development of placenta, the expression level of NADK appears drastically elevated (Lerner et al., 2001).
Fstl1 is a secreted glycoprotein belonging to the BM-40/SPARC/osteonectin family containing both calcium-binding domain and Follistatin-like domain (Hambrock et al., 2004). As a mesenchymal factor, Fstl1 is critical for oviduct development, and determines the differentiation of secretary epithelial cells and ciliated epithelial cells in the oviduct (Umezu et al., 2010). This means Fstl1 may modulate chicken endometrium development during eggshell formation. However, Fstl1 is also present in the organic part of eggshells (Mann et al., 2006), and Jonchère et al. (2010) propose it may be a uterine antiprotease

IMPLICATIONS

Above all, using Affymetrix Chicken Array, 1,195 DE-transcripts were identified in the shell gland between “high shell strength” and “low shell strength” hens, which represent 941 unique known genes. According to gene ontology annotations, these transcripts are involved in a wide range of biological processes; the most prominent DE-transcripts relate to signal transduction, metabolism, extracellular matrix, or ion transport and homeostasis, and so on. Furthermore, Gene Ontology (GO) term enrichment of DE-transcripts suggests that avian eggshell calcification is likely to be regulated by relative reproductive hormones and neurotransmitters, which may finally affect eggshell quality through a complex suite of biophysical processes.

ACKNOWLEDGMENTS

This work was supported by National Natural Science Foundation of China (grant no. 30700567) and Zhejiang Provincial Natural Science Foundation of China (grant no. LY12C17002).

Figure 1.
Eggs and forming eggshells obtained from hen shell glands at the moment of tissue sampling. Figure 1A: Eggs obtained from the shell glands of hens when sampling uterus tissues. A-I is the egg from #35 hen, A-II from #19 hen, A-III from #80 hen, A-IV from #40 hen; these hens were all slaughtered at about 9 h after previous oviposition (P.O.). While A-V and A-VI eggs are from another 2 hens culled at 11.5 to 12 h after P.O., respectively. Figure 1B: The forming “shell” sampled at different stage of eggshell formation. B-I is the “shell” from the hen slaughtered at 4 h after P.O.; B-II is the “shell” of above egg from #40 hen. B-III is the “shell” sampled at 12 h post oviposition.
ajas-26-5-609-2f1.gif
Figure 2.
Heatmap and dendrogram of differentially expressed transcripts (DE-transcripts). Each cell represents the (normalized) gene expression value for given DE-transcript (row) in the specified sample (column). Cell colors indicate gene expression level: red: highly expressed; yellow: medium expression; green: lowly expressed. Row-side and column-side dendrogram represent the hierarchical clustering of DE-transcript expression for different transcripts or samples, respectively. Clustering is based on “complete-linkage” method using Euclidean-distance.
ajas-26-5-609-2f2.gif
Figure 3.
Real-time RT-PCR validation of microarray data. Expression levels of the first 12 transcripts (AMDHD1, ATP6V1A, CRYBB1 FGB, GAS2L3, GIT2, MAN1A2, NDST4, PLCXD1, RCJMB04-34k20, SLC8A1 and TBXAS1) were down-regulated in microarray experiment, and the last 9 transcripts (ACYP2, CA5B, CHST3, COL12A1, CRABP1, EXOC6B, LOC416916, NPY and WDR72) were up-regulated in microarray experiment. Among the above transcripts, five transcripts (CRYBB1, MAN1A2, CHST3, EXOC6B and LOC416916) failed to be verified by real-time RT-PCR.
ajas-26-5-609-2f3.gif
Figure 4.
MA-plot of all microarray tested chicken-genes. X-axis: the average normalized expression values across all 4 (strong+weak) eggshell samples (in Log2 scale); Y-axis: the log-odds ratio between the average expression values of strong vs. weak eggshell samples; grey dots: nondifferentially expressed genes (non-DE genes); red dots: differentially expressed genes (DE-genes) identified in this study; big blue dots: DE-genes (CALD1, NADK, LOC422993, LAMP3, P2RX4, FSTL1, TUBGCP4, WDR77, RCJMB04_6g16, PWP1 and SGK1) reported in previous studies.
ajas-26-5-609-2f4.gif
Table 1.
Descriptions of specific primers used for real-time RT-PCR
Gene symbol Accession no. Forward primer (5′-3′) Reverse primer (5′-3′) Amplicon (bp)
ACYP2 XM_419292 CGGCTCGCTCAAGTCGGTGG GGCCCTGAACTTGGCCCGTC 152
AMDHD1 XM_416158 GCACTGGGAAGTGCGTATTGCCA TCTTCCGTGGCCTTCCTGGTGT 175
ATP6V1A NM_204974 TGCAACATGGCAGGTGCTGCT TGCCAGGCCCCAGTTCCACT 187
CA5B XM_414195 CAGCTTGGCCACCTGCACTCC ACACGTCGCTGGGTCGTAGCT 175
CHST3 NM_205121 TGATGGCCACCACACGCACC CTGCAGCACGTCGCGGTACA 170
COL12A1 NM_205021 AGGCGAGTCTTCCCCGACGG GCGCTGTCCTCATGTCTGCCC 171
CRABP1 NM_001030539 CGCCCCGCCATGCCTAACTT AACTGGTCCCCGTCCTGGCG 161
CRYBB1 NM_204180 ACCTGGCGGACTGCGGGTT CGGTAGCTGCTGGACCAGGTG 151
EXOC6B XM_420892 AACCCCACCACAGCCCTCGT TGGCTGTTGATGAGGCCGCG 149
FGB XM_420369.2 GCTGCTCCTGCTGCTCCTGC GTGCCACGGGCCTGAGTGTG 155
GAS2L3 XM_416172 GGAGTAGTGCTGGCAGTCCTGC CCTGGGCCGTGTCTGGGAGT 193
GIT2 NM_204206 TCGCTTGCCATGCCGTGAGG GCAACGTGGAGCGGGGTGTT 168
MAN1A2 XM_416490 ACGTGGACACCAGCAAGGGGG TCCTTTGCCTCTTCCAGGGCCTTT 148
NDST4 XM_420638 CGAGCAGCTTCCCTCATCCCCAA TGCCCAGGGGCTTGACGTAA 156
NPY NM_204587 GAGGACGCTCCCGCAGAGGA TCGAAGGGTCTTCAAACCGGGA 175
OC416916 XM_415207 TGGAGGTGGAGCACAAACATCTGC CCACCGAGCACACAGCCAGAAA 200
PLCXD1 NM_001128637 CCTGGCCTGCAGGAATTTTGATGG AGCCACGCTGCCACATGGTC 137
RCJMB04_34k20 NM_001031112 GGACAGGCGGGCGAGAGAGT TGGTGGTAACACGCACGCTGA 126
SLC8A1 XM_415002 CGTGTTTGTGGCACTGGGGACA ATGGCCGCGATGGACCAAGC 159
TBXAS1 XM_416334 TGTGTGGTGCTGGGACAGCGT ATACAGCCACGGGGTCCTGCT 188
WDR72 XM_425069 GGCTGTTATCAGGGGGCCAGGA GCACACGCAGCACACTACGC 161
GAPDH NM_204305 GGGCTGCTAAGGCTGTGGGG TCAGGGGCCCATCAGCAGCA 177
Table 2.
Parameters related to eggshell quality of hens in this study
Hen shell strength (kgf) shell thickness (mm) shell index (g/100 cm2) shell weight (g) egg weight (g) shape index
#40 5.17±0.40 A 0.367±0.016 A 8.07±0.28 A 4.297±0.144 a 38.46±1.52 C 1.274±0.024 B
#19 4.75±0.21 A 0.328±0.012 B 7.18±0.25 B 3.968±0.195 b 40.72±1.26 B 1.322±0.030 A
#35 2.99±0.71 B 0.324±0.023 B 6.97±0.68 B 4.363±0.426 a 48.60±1.38 A 1.278±0.032 AB
#80 2.54±0.69 B 0.272±0.022 C 6.25±0.71 C 3.451±0.417 c 40.58±1.06 B 1.313±0.052 AB

Values are from eggs laid by each hen of interest during the period of observation. Distinct capital letters in the same column indicate parameters between hens with a significant difference (p< 0.01), and distinct small letters indicate the significant difference is at level p<0.05.

Table 3. i)
DE-transcripts related with signaling, ion transportation, extracellular matrix protein, and carbohydrate metabolism or post-translation glycosylation modification
Gene symbol Transcript ID Log2 units (strong VS weak) p-value Category
LOC771699 XM_001234946 3.853 0.0004 signaling
SH3PXD2A XM_421741 3.410 0.0397 signaling
LOC429955 XM_427511 3.296 0.0034 signaling
PDCL2 XM_420702 3.100 0.0115 signaling
LOC430487 XM_428042 3.055 0.0074 signaling
SEMA3G XM_414289 2.933 0.0213 signaling
RHOBTB2 XM_001232709 2.905 0.0069 signaling
RXFP1 XM_420385 2.795 0.0205 signaling
PIK3C2B XM_417956 2.777 0.0194 signaling
OR10A7 XM_425093 2.768 0.0067 signaling
NPY NM_205473 2.401 0.0329 signaling
PDE8B XM_425218 2.401 0.0498 signaling
GREM2 XM_419552 2.284 0.0423 signaling
Table 3. ii)
DE-transcripts related with signaling, ion transportation, extracellular matrix protein, and carbohydrate metabolism or post-translation glycosylation modification
Gene symbol Transcript ID Log2 units (strong VS weak) p-value Category
SPAG9 XM_420098 2.215 0.0423 signaling
LOC396365 NM_205400 2.166 0.0009 signaling
MAPKBP1 XR_026772 2.157 0.0187 signaling
OXTR NM_001031569 2.128 0.0134 signaling
STC2 XM_414534 2.120 0.0135 signaling
MPP3 XM_418108 1.921 0.0491 signaling
GREM1 NM_204978 1.903 0.0220 signaling
C20orf32 XM_417499 1.889 0.0117 signaling
CRABP1 NM_001030539 1.778 0.0115 signaling
C1orf107 NM_001031051 1.770 0.0411 signaling
RGS9 XM_415685 1.657 0.0177 signaling
ARHGEF12 XM_417890 1.437 0.0014 signaling
LTBP3 XM_426444 1.433 0.0409 signaling
NGEF NM_001010841 1.390 0.0307 signaling
PDE1A XM_421969 1.363 0.0127 signaling
CRHBP XM_424801 1.355 0.0159 signaling
SRGAP1 NM_001080101 1.335 0.0426 signaling
PDE9A XM_416748 1.196 0.0475 signaling
NPFFR2 NM_001034825 1.124 0.0283 signaling
WNT4 NM_204783 1.114 0.0180 signaling
FGD4 XM_416365 1.099 0.0121 signaling
SOCS2 NM_204540 1.033 0.0377 signaling
TOB1 NM_001001467 1.015 0.0347 signaling
RND3 XM_422158 0.887 0.0094 signaling
ARHGAP28 XM_419140 −4.485 0.0231 signaling
WNT3 NM_204675 −3.902 0.0422 signaling
LOC428961 NM_001142671 −3.469 0.0058 signaling
VAV2 NM_204142 −3.397 0.0232 signaling
TBC1D20 XM_001235014 −3.154 0.0389 signaling
HTT XM_420822 −3.086 0.0065 signaling
P2RY2 XM_425667 −3.079 0.0294 signaling
GRAP2 XM_001234081 −2.967 0.0402 signaling
INPP4A XM_416886 −2.749 0.0130 signaling
ITSN1 XM_416715 −2.744 0.0139 signaling
EDNRB2 NM_204120 −2.644 0.0317 signaling
FGB XM_420369 −2.631 0.0194 signaling
RXFP3 XM_429217 −2.616 0.0048 signaling
LOC420403 XM_418509 −2.531 0.0049 signaling
SSTR3 NM_001024583 −2.501 0.0203 signaling
GPR39 NM_001080105 −2.376 0.0087 signaling
GPR97 XM_413998 −2.356 0.0230 signaling
FGF14 NM_204777 −2.322 0.0175 signaling
SFRP4 XM_418831 −2.204 0.0162 signaling
LOC430333 XM_001235474 −1.880 0.0153 signaling
GARNL1 XM_421244 −1.850 0.0477 signaling
RAPH1 XM_421961 −1.842 0.0035 signaling
C14orf138 XM_421460 −1.756 0.0012 signaling
LOC421876 XM_419893 −1.750 0.0333 signaling
NLE1 XM_415857 −1.735 0.0463 signaling
CHRM2 NM_001030765 −1.721 0.0310 signaling
Table 3. iii)
DE-transcripts related with signaling, ion transportation, extracellular matrix protein, and carbohydrate metabolism or post-translation glycosylation modification
Gene symbol Transcript ID Log2 units (strong VS weak) p-value Category
LOC768958 XM_001232128 −1.622 0.0278 signaling
RASL10B XM_001233673 −1.546 0.0473 signaling
SIPA1L2 XM_419564 −1.545 0.0020 signaling
LOC769317 XM_001231944 −1.531 0.0287 signaling
PLXDC2 XM_418613 −1.503 0.0155 signaling
SPOCK1 XM_414622 −1.491 0.0375 signaling
CSF2RB XM_001234608 −1.468 0.0498 signaling
LOC429163 XM_426718 −1.434 0.0220 signaling
PLXNC1 XM_416143 −1.398 0.0103 signaling
RCJMB04_19g9 XM_419989 −1.339 0.0019 signaling
PLXNA1 XM_414370 −1.305 0.0467 signaling
TSPAN5 XM_420654 −1.277 0.0142 signaling
LOC431251 NM_001127171 −1.226 0.0414 signaling
ANXA10 XM_001233661 −1.176 0.0441 signaling
RCJMB04_18c11 NM_001012909 −1.153 0.0436 signaling
SPRED2 XM_419341 −1.124 0.0146 signaling
MOBKL1A XM_420601 −1.116 0.0026 signaling
ALS2CL XR_026875 −1.038 0.0119 signaling
MPP1 NM_001007917 −1.036 0.0424 signaling
FGF12 NM_204888 −1.016 0.0006 signaling
GNA13 XM_415686 −1.007 0.0195 signaling
ARL10 XM_414552 −0.975 0.0492 signaling
ADRA2B XM_425203 −0.885 0.0415 signaling
CCKAR NM_001081501 −0.868 0.0352 signaling
RCJMB04_3n15 NM_001030902 −0.815 0.0373 signaling
TBC1D24 XM_001232296 4.629 0.0023 IT
SCN9A XM_422021 3.745 0.0047 IT
KCNT2 XM_426614 3.077 0.0015 IT
LOC395893 3.030 0.0392 IT
NIPAL4 XM_414566 2.796 0.0163 IT
ATP6V0A4 NM_001080102 2.790 0.0397 IT
GRIN2B XM_416204 2.781 0.0291 IT
KCNJ1 XM_425795 2.363 0.0011 IT
POR XM_415768 2.294 0.0047 IT
KCNK2 XM_001234269 2.270 0.0447 IT
KIRREL3 XR_026874 2.143 0.0193 IT
GABRG2 NM_205345 1.985 0.0176 IT
SLC4A1 NM_205522 1.794 0.0041 IT
NDUFA7 XM_418185 0.995 0.0464 IT
JPH3 XM_414192 0.925 0.0193 IT
CACNA2D1 XM_001231265 0.852 0.0429 IT
EFCAB5 XM_415833 −3.593 0.0342 IT
SPATA22 XM_001235167 −3.590 0.0176 IT
RCJMB04_1f1 NM_001031133 −3.197 0.0328 IT
LOC428404 XM_425965 −3.177 0.0442 IT
ATP13A3 XM_422709 −3.059 0.0065 IT
GABRB2 XM_001232377 −2.963 0.0472 IT
SLC8A1 NM_001079473 −2.694 0.0342 IT
CACNA2D3 XM_414338 −2.622 0.0100 IT
SERINC5 XM_424762 −2.615 0.0129 IT
Table 3. iv)
DE-transcripts related with signaling, ion transportation, extracellular matrix protein, and carbohydrate metabolism or post-translation glycosylation modification
Gene symbol Transcript ID Log2 units (strong VS weak) p-value Category
LOC421866 XR_027148 −2.613 0.0307 IT
LOC425295 XM_423073 −2.586 0.0212 IT
LOC772391 XM_001235535 −2.573 0.0163 IT
KCNK17 XM_419477 −2.506 0.0047 IT
KCTD16 XM_425217 −2.363 0.0076 IT
CNNM1 XM_421703 −2.309 0.0446 IT
KCNJ5 XM_417864 −2.138 0.0324 IT
RCJMB04_11e10 NM_001030630 −2.102 0.0226 IT
GRIN3A XM_001232181 −1.680 0.0355 IT
ATP6V1A NM_204974 −1.202 0.0065 IT
RCJMB04_16a12 NM_001031305 −1.030 0.0261 IT
CNGA3 NM_205221 −0.962 0.0479 IT
P2RX4 NM_204291 −0.882 0.0252 IT
MEGF10 XM_424719 3.910 0.0398 EM
FAT2 XM_414584 3.892 0.0052 EM
SDK2 NM_204538 2.905 0.0097 EM
NRXN3 XM_421297 2.643 0.0139 EM
LAMA4 XM_419780 2.569 0.0322 EM
NTNG1 XM_001231446 2.004 0.0328 EM
CRTAC1 NM_001080211 1.930 0.0132 EM
LAMC1 NM_204166 1.680 0.0257 EM
LAMB4 XM_001232877 1.642 0.0161 EM
PPFIA1 XM_421074 1.583 0.0166 EM
CLDN20 XM_001232002 1.438 0.0101 EM
CDH9 XM_001231501 1.296 0.0311 EM
CHAD XM_416236 1.268 0.0240 EM
LOC396026 NM_205128 1.239 0.0403 EM
PCDH21 NM_001001759 1.174 0.0187 EM
EPDR1 XM_418830 1.158 0.0469 EM
CPNE8 XM_001231388 1.121 0.0219 EM
COL12A1 NM_205021 0.996 0.0003 EM
PKP2 XM_416362 0.983 0.0447 EM
CD72 NM_205052 0.855 0.0263 EM
NINJ2 XM_416382 −4.039 0.0409 EM
OTOF XM_420015 −3.980 0.0016 EM
COL13A1 XM_001232218 −3.260 0.0006 EM
SVEP1 XM_424917 −2.967 0.0250 EM
OTOP1 XM_420790 −2.830 0.0263 EM
GPNMB XM_425991 −2.771 0.0327 EM
PKP1 XM_419240 −2.349 0.0324 EM
LAMA2 XM_419746 −2.336 0.0000 EM
COL8A2 XM_425780 −2.295 0.0170 EM
FNBP4 XM_424260 −2.279 0.0486 EM
EGFL6 XM_416835 −2.268 0.0392 EM
CDH18 XM_426046 −1.955 0.0090 EM
CLDN8 XM_425544 −1.598 0.0288 EM
RCJMB04_34k20 NM_001031112 −1.214 0.0085 EM
SRPX XM_416781 −1.123 0.0244 EM
DLG1 XM_422701 −1.084 0.0171 EM
FBLN1 NM_204165 −0.981 0.0206 EM
Table 3. v)
DE-transcripts related with signaling, ion transportation, extracellular matrix protein, and carbohydrate metabolism or post-translation glycosylation modification
Gene symbol Transcript ID Log2 units (strong VS weak) p-value Category
F13A1 NM_204685 −0.949 0.0234 EM
FREM1 XM_424932 −0.910 0.0057 EM
MEGF10 XM_424719 3.910 0.0398 EM
MGAT4C XM_425447 3.007 0.0497 GM or CM
CHST3 NM_205121 2.839 0.0372 GM or CM
EDEM3 XM_422293 2.539 0.0179 GM or CM
LARGE NM_001004404 2.071 0.0429 GM or CM
GFPT2 XM_424573 1.919 0.0173 GM or CM
GALNTL1 XM_001231964 1.895 0.0452 GM or CM
WDR77 NM_001030916 1.805 0.0445 GM or CM
NDST3 XM_426325 1.403 0.0121 GM or CM
B3GALT1 XM_426584 1.254 0.0483 GM or CM
OGDHL XM_421503 1.144 0.0022 GM or CM
MAN1A2 XM_416490 −4.700 0.0087 GM or CM
POFUT2 XM_421892 −2.804 0.0156 GM or CM
LOC772154 XM_001235329 −2.798 0.0006 GM or CM
KLB XM_423224 −2.335 0.0380 GM or CM
TRIM7.2 NM_001099354 −1.986 0.0041 GM or CM
LOC771361 XM_001234647 −1.433 0.0369 GM or CM
RCJMB04_28l23 NM_001039316 −1.324 0.0034 GM or CM
NDST4 XM_420638 −1.239 0.0261 GM or CM
PFKM NM_204223 −1.170 0.0460 GM or CM
NUP153 XM_418937 −1.109 0.0378 GM or CM
GPD1L XM_418763 −0.947 0.0383 GM or CM
PHKA2 XM_416811 −0.926 0.0326 GM or CM
B3GNTL1 XM_415599 −0.883 0.0109 GM or CM
PMM1 XM_416228 −0.787 0.0490 GM or CM
MMP11 XM_001232776 2.209 0.0391 GM or CM
ST3GAL4 XM_417860 −1.043 0.0094 GM or CM

IT represents ion/proton transporter, EM represents extracellular matrix, GM represents post-translation glycosylation modification, and CM represents carbohydrate metabolism.

Table 4.
Enriched gene ontology (GO) terms revealed from identified DE-transcripts according to biological_process ontology
Group GOID Term p Gene symbol or representative public ID
Reproductive hormone synthesis and regulation GO:0060126 Somatotropin secreting cell differentiation 0.013 OTX2, WNT4
GO:0021984 Adenohypophysis development 0.044 OTX2, WNT4
GO:0032355 Response to estradiol stimulus 0.044 SOCS2, AREGB
Signal transduction GO:0030514 Negative regulation of BMP signaling pathway 0.030 TOB1, GREM1
Biophysical processes GO:0048741 Skeletal muscle fiber development 0.012 SLC23A2, CHAT
GO:0015074 DNA integration 0.012 LOC770294, LOC770705, ENS-3
GO:0055117 Regulation of cardiac muscle contraction 0.013 P2RX4, NKX2–5
GO:0009409 Response to cold 0.018 IL4, SLC27A1
GO:0048747 Muscle fiber development 0.022 SLC23A2, CHAT
GO:0046209 Nitric oxide metabolic process 0.024 P2RX4, CPS1
GO:0007586 Digestion 0.030 PGA5, PRSS2, LOC396365
GO:0015849 Organic acid transport 0.033 SLC23A2, OCA2, LOC770309, SLC7A14, SLC27A1
GO:0046942 Carboxylic acid transport 0.033 SLC23A2, OCA2, LOC770309, SLC7A14, SLC27A1
GO:0055002 Striated muscle cell development 0.034 SLC23A2, CHAT, TTN, NKX2–5
GO:0006942 Regulation of striated muscle contraction 0.037 P2RX4, NKX2–5
GO:0002028 Regulation of sodium ion transport 0.044 NKX2–5, NEDD4L
Reproductive biophysical processes GO:0060748 Tertiary branching involved in mammary gland duct morphogenesis 0.009 WNT4, AR
GO:0060745 Mammary gland branching involved in pregnancy 0.013 WNT4, AR
GO:0060562 Epithelial tube morphogenesis 0.019 DEAF1, WNT3, GREM1, WNT4, NKX2–5, HOXA11, AR, AREGB
GO:0060444 Branching involved in mammary gland duct morphogenesis 0.020 WNT4, AR, AREGB
GO:0009994 Oocyte differentiation 0.024 WNT4, GDF9
GO:0048599 Oocyte development 0.024 WNT4, GDF9
GO:0060603 Mammary gland duct morphogenesis 0.033 WNT4, AR, AREGB
GO:0060135 Maternal process involved in female pregnancy 0.037 WNT4, AR

GOID represents the identifiers, and Term represents term definitions for Gene Ontology term entities. p: p-value of significance (Welch t-test).

Table 5.
Enriched gene ontology (GO) terms revealed from identified DE-transcripts according to molecular function ontology
Group GOID Term p Gene symbol or representative public ID
Signal transduction GO:0005030 Neurotrophin receptor activity 0.013 NTRK1, NTRK2
GO:0001614 Purinergic nucleotide receptor activity 0.017 P2RX4, P2RY2, ENSGALG00000012080
GO:0016502 Nucleotide receptor activity 0.017 P2RX4, P2RY2, ENSGALG00000012080
GO:0043121 Neurotrophin binding 0.024 NTRK1, NTRK2
GO:0035586 Purinergic receptor activity 0.026 P2RX4, P2RY2, ENSGALG00000012080
GO:0004888 Transmembrane signaling receptor activity 0.049 OXTR, LOC431251, SSTR3, CHRM2, ADRA2B, P2RX4, P2RY2, EDNRB2, GABRB2, GABRG2, LOC428961, NPFFR2, GRIN2B, GRIN3A, NTRK1, NTRK2, EPHB6, DDR2, TMPRSS6, PCSK5, CCKAR, IFNAR2, CSF1R, TLR5, OR10A7, LOC768958, LOC769317, LOC777484, GPR39, GPR97, ENSGALG00000017405, ENSGALG00000017093, ENSGALG00000012080.
Biophysical processes GO:0003951 NAD+ kinase activity 0.013 C5orf33, NADK
GO:0005319 Lipid transporter activity 0.049 ATP11C, ATP8A2, ATP8B3, APOB, LOC769564, SLC27A1

GOID represents the identifiers, and Term represents term definitions for gene ontology term entities. p: p-value of significance (Welch t-test).

REFERENCES

Ahmed AMH, Rodriguez-Navarro AB, Vidal ML, Gautron J, Garcia-Ruiz JM, Nys Y. 2005. Changes in eggshell mechanical properties, crystallographic texture and in matrix proteins induced by moult in hens. Br Poult Sci 46:268–279.
crossref pmid
Barrionuevo FJ, Burgos M, Scherer G, Jiménez R. 2012. Genes promoting and disturbing testis development. Histol Histopathol 27:1361–1383.
pmid
Burnashev N. 1998. Calcium permeability of ligand-gated channels. Cell Calcium 24:325–332.
crossref pmid
Boyer A, Lapointe É, Zheng X, Cowan RG, Li H, Quirk SM, DeMayo FJ, Richards JS, Boerboom D. 2010. WNT4 is required for normal ovarian follicle development and female fertility. FASEB J 24:3010–3025.
crossref pmid pmc
Carrino DA, Rodriguez JP, Caplan AI. 1997. Dermatan sulfate proteoglycans from the mineralized matrix of the avian eggshell. Connect Tissue Res 36:175–193.
crossref pmid
Chen B, Suo P, Wang B, Wang J, Yang L, Zhou S, Zhu Y, Ma X, Cao Y. 2011. Mutation analysis of the WNT4 gene in Han Chinese women with premature ovarian failure. Reprod Biol Endocrinol 9:75
crossref pmid pmc
Cheuk BL, Cheng SW. 2011. Differential expression of elastin assembly genes in patients with Stanford Type A aortic dissection using microarray analysis. J Vasc Surg 53:1071–1078.
crossref pmid
Childs TJ, Watson MH, Sanghera JS, Campbell DL, Pelech SL, Mak AS. 1992. Phosphorylation of smooth muscle caldesmon by mitogen-activated protein (MAP) kinase and expression of MAP kinase in differentiated smooth muscle cells. J Biol Chem 267:22853–22859.
pmid
Creger CR, Phillips H, Scott JT. 1976. Formation of an eggshell. Poult Sci 55:1717–1723.
crossref
Diaz FJ, Anthony K, Halfhill AN. 2011. Early avian follicular development is characterized by changes in transcripts involved in steroidogenesis, paracrine signaling and transcription. Mol Reprod Dev 78:212–223.
crossref pmid
Dunn IC, Wilson PW, Lu Z, Bain MM, Crossan CL, Talbot RT, Waddington D. 2009. New hypotheses on the function of the avian shell gland derived from microarray analysis comparing tissue from juvenile and sexually mature hens. Gen Comp Endocrinol 163:225–232.
crossref pmid
Fodor J, Matta C, Juhász T, Oláh T, Gönczi M, Szíjgyártó Z, Gergely P, Csernoch L, Zákány R. 2009. Ionotropic purinergic receptor P2X4 is involved in the regulation of chondrogenesis in chicken micromass cell cultures. Cell Calcium 45:421–430.
crossref pmid
Franco HL, Dai D, Lee KY, Rubel CA, Roop D, Boerboom D, Jeong JW, Lydon JP, Bagchi IC, Bagchi MK, Demayo FJ. 2011. WNT4 is a key regulator of normal postnatal uterine development and progesterone signaling during embryo implantation and decidualization in the mouse. FASEB J 25:1176–1187.
crossref pmid pmc
Gautron J, Hincke MT, MANN K, Panhéleux M, Bain M, McKee MD, Solomon SE, Nys Y. 2001a. Ovocalyxin-32, a novel chicken eggshell matrix protein: Isolation, amino acid sequencing, cloning and immunocytochemical localization. J Biol Chem 276:39243–39252.
crossref
Gautron J, Hincke MT, Panhéleux M, Garcia-Ruiz JM, Boldicke T, Nys Y. 2001b. Ovotransferrin is a matrix protein of the hen eggshell membranes and basal calcified layer. Connect Tissue Res 42:255–267.
crossref
Gautron J, Murayama E, Vignal A, Morisson M, McKee MD, Réhault S, Labas V, Belghazi M, Vidal ML, Nys Y, Hincke MT. 2007. Cloning of Ovocalyxin-36, a novel chicken eggshell protein related to lipopolysaccharide-binding proteins (LBP), bactericidal permeability-increasing proteins (BPI), and plunc family proteins. J Biol Chem 282:5273–5286.
crossref pmid
Greenfield EM, Wilson DC, Crenshaw MA. 1984. Ionotropic nucleation of calcium carbonate by molluscan matrix. Amer Zool 24:925–932.
crossref
Hambrock HO, Kaufmann B, Müller S, Hanisch FG, Nose K, Paulsson M, Maurer P, Hartmann U. 2004. Structural characterization of TSC-36/Flik: Analysis of two charge isoforms. J Biol Chem 279:11727–11735.
crossref pmid
Hincke MT. 1995. Ovalbumin is a component of the chicken eggshell matrix. Connect Tissue Res 31:227–233.
crossref pmid
Hincke MT, Gautron J, Panhéleux M, Garcia-Ruiz J, McKee MD, Nys Y. 2000. Identification and localization of lysozyme as a component of eggshell membranes and eggshell matrix. Matrix Biol 19:443–453.
crossref pmid
Hincke MT, Tsang CP, Courtney M, Hill V, Narbaitz R. 1995. Purification and immunochemistry of a soluble matrix protein of the chicken eggshell (Ovocleidin 17). Calcif Tissue Int 56:578–583.
crossref pmid
Hsieh M, Johnson MA, Greenberg NM, Richards JS. 2002. Regulated expression of Wnts and Frizzleds at specific stages of follicular development in the rodent ovary. Endocrinology 143:898–908.
crossref pmid
Johnson AL. 1986. Reproduction in the female. Avian Physiology. 4th edSturkie PD. Springer-Verlag; New York:

Jonchère V, Réhault-Godbert S, Hennequet-Antier C, Cabau C, Sibut V, Cogburn LA, Nys Y, Gautron J. 2010. Gene expression profiling to identify eggshell proteins involved in physical defense of the chicken egg. BMC Genomics 11:57–75.
crossref pmid pmc
Kelley CG, Lavorgna G, Clark ME, Boncinelli E, Mellon PL. 2000. The Otx2 homeoprotein regulates expression from the gonadotropin-releasing hormone proximal promoter. Mol Endocrinol 14:1246–1256.
crossref pmid
Khuong TT, Jeong DK. 2011. Adipogenic differentiation of chicken epithelial oviduct cells using only chicken serum. In Vitro. Cell Dev Biol Anim 47:609–614.
crossref
Lakshminarayanan R, Kini RM, Valiyaveettil S. 2002. Investigation of the role of ansocalcin in the biomineralization in goose eggshell matrix. Proc Natl Acad Sci USA 99:5155–5159.
crossref pmid pmc
Lavelin I, Meiri N, Einat M, Genina O, Pines M. 2002. Mechanical strain regulation of the chicken glypican-4 gene expression in the avian eggshell gland. Am J Physiol Regul Integr Comp Physiol 283:R853–R861.
crossref pmid
Lavelin I, Yarden N, Ben-Bassat S, Bar A, Pines M. 1998. Regulation of osteopontin gene expression during egg shell formation in the laying hen by mechanical strain. Matrix Biol 17:615–623.
crossref pmid
Layman WS, Hurd EA, Martin DM. 2011. Reproductive dysfunction and decreased GnRH neurogenesis in a mouse model of CHARGE syndrome. Hum Mol Genet 20:3138–3150.
crossref pmid pmc
Lerner F, Niere M, Ludwig A, Ziegler M. 2001. Structural and functional characterization of human NAD kinase. Biochem Biophys Res Commun 288:69–74.
crossref pmid
Mann K. 1999. Isolation of a glycosylated form of the chicken eggshell protein ovocleidin and determination of the glycosylation site. Alternative glycosylation/phosphorylation at an N-glycosylation sequon. FEBS Lett 463:12–14.
crossref pmid
Mann K, Gautron J, Nys Y, McKee MD, Bajari T, Schneider WJ, Hincke MT. 2003. Disulfide-linked heterodimeric clusterin is a component of the chicken eggshell matrix and egg white. Matrix Biol 22:397–407.
crossref pmid
Mann K, Maček B, Olsen JV. 2006. Proteomic analysis of the acid-soluble organic matrix of the chicken calcified eggshell layer. Proteomics 6:3801–3810.
crossref pmid
Mann K, Olsen JV, Maček B, Gnad F, Mann M. 2007. Phosphoproteins of the chicken eggshell calcified layer. Proteomics 7:106–115.
crossref pmid
Nishii N, Nejime N, Yamauchi C, Yanai N, Shinozuka K, Nakabayashi T. 2009. Effects of ATP on the intracellular calcium level in the osteoblastic TBR31-2 cell line. Biol Pharm Bull 32:18–23.
crossref pmid
Nys Y, Gautron J, Garcia-Ruiz JM, Hincke MT. 2004. Avian eggshell mineralization: biochemical and functional characterization of matrix proteins. C R Palevol 3:549–562.
crossref
Ohira K, Hayashi M. 2009. A new aspect of the TrkB signaling pathway in neural plasticity. Curr Neuropharmacol 7:276–285.
crossref pmid pmc
Orriss IR, Utting JC, Brandao-Burch A, Colston K, Grubb BR, Burnstock G, Arnett TR. 2007. Extracellular nucleotides block bone mineralization in vitro: Evidence for dual inhibitory mechanisms involving both P2Y2 receptors and pyrophosphate. Endocrinology 148:4208–4216.
crossref pmid
Peluffo MC, Murphy MJ, Baughman ST, Stouffer RL, Hennebold JD. 2011. Systematic analysis of protease gene expression in the rhesus macaque ovulatory follicle: metalloproteinase involvement in follicle rupture. Endocrinology 152:3963–3974.
crossref pmid pmc
Pines M, Knopov V, Bar A. 1995. Involvement of osteopontin in egg shell formation in the laying chicken. Matrix Biol 14:765–771.
crossref pmid
Pollak N, Niere M, Ziegler M. 2007. NAD kinase levels control the NADPH concentration in human cells. J Biol Chem 282:33562–33571.
crossref pmid
Reyes-Grajeda JP, Moreno A, Romero A. 2004. Crystal structure of ovocleidin-17, a major protein of the calcified Gallus gallus eggshell. J Biol Chem 279:40876–40881.
crossref pmid
Ramakers C, Ruijter JM, Deprez RH, Moorman AF. 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339:62–66.
crossref pmid
Rhinn M, Dierich A, Shawlot W, Behringer RR, Le Meur M, Ang SL. 1998. Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification. Development 125:845–856.
pmid
Ruijter JM, Ramakers C, Hoogaars WM, Karlen Y, Bakker O, van den Hoff MJ, Moorman AF. 2009. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res 37:e45–e45.
crossref pmid pmc
Sauveur B, Reviers M. 1988. Reproduction des volailles et production d’œufs. INRA Editions; Paris:

Solomon SE. 1999. Gordon Memorial Lecture. An egg ist ein ei, es un huevo, est un oeuf. Br Poult Sci 40:5–11.
crossref pmid
Sutherland C, Renaux BS, Mckay DJ, Walsh MP. 1994. Phosphorylation of caldesmon by smooth-muscle casein kinase II. J Muscle Res Cell Motil 15:440–456.
crossref pmid
Umezu T, Yamanouchi H, Iida Y, Miura M, Tomooka Y. 2010. Follistatin-like-1, a diffusible mesenchymal factor determines the fate of epithelium. Proc Natl Acad Sci USA 107:4601–4606.
crossref pmid pmc
Veis A. 1989. Chemical and biochemical perspectives. Biomineralization. Mann S, Webb J, Williams RJP, editorsp. 189VCH; Weinhein, New York:

Yang KT, Lin CY, Liou JS, Fan YH, Chiou SH, Huang CW, Wu CP, Lin EC, Chen CF, Lee YP, Lee WC, Ding ST, Cheng WT, Huang MC. 2007. Differentially expressed transcripts in shell glands from low and high egg production strains of chickens using cDNA microarrays. Anim Reprod Sci 101:113–124.
crossref pmid
Yoshizaki K, Yamamoto S, Yamada A, Yuasa K, Iwamoto T, Fukumoto E, Harada H, Saito M, Nakasima A, Nonaka K, Yamada Y, Fukumoto S. 2008. Neurotrophic factor neurotrophin-4 regulates ameloblastin expression via full-length TrkB. J Biol Chem 283:3385–3391.
crossref pmid
Zheng Q, Wang XJ. 2008. GOEAST: a web-based software toolkit for Gene Ontology enrichment analysis. Nucleic Acids Res 36:358–363.
crossref pmid pmc
Zmuda JM, Yerges-Armstrong LM, Moffett SP, Klei L, Kammerer CM, Roeder K, Cauley JA, Kuipers A, Ensrud KE, Nestlerode CS, Hoffman AR, Lewis CE, Lang TF, Barrett-Connor E, Ferrell RE, Orwoll ES; Osteoporotic Fractures in Men (MrOS) Study Group. 2011. Genetic analysis of vertebral trabecular bone density and cross-sectional area in older men. Osteoporos Int 22:1079–1090.
crossref pmid pmc
TOOLS
METRICS Graph View
  • 8 Crossref
  • 8 Scopus
  • 6,945 View
  • 60 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : jongkha@hotmail.com               

Copyright © 2020 by Asian-Australasian Journal of Animal Sciences. All rights reserved.

Close layer
prev next