Go to Top Go to Bottom
Asian-Australas J Anim Sci > Volume 27(8); 2014 > Article
Manatbay, Cheng, Mao, and Zhu: Effect of Gynosaponin on Rumen In vitro Methanogenesis under Different Forage-Concentrate Ratios


The study aimed to investigate the effects of gynosaponin on in vitro methanogenesis under different forage-concentrate ratios (F:C ratios). Experiment was conducted with two kinds of F:C ratios (F:C = 7:3 and F:C = 3:7) and gynosaponin addition (0 mg and 16 mg) in a 2×2 double factorial design. In the presence of gynosaponin, methane production and acetate concentration were significantly decreased, whereas concentration of propionate tended to be increased resulting in a significant reduction (p<0.05) of acetate:propionate ratio (A:P ratio), in high-forage substrate. Gynosaponin treatment increased (p<0.05) the butyrate concentration in both F:C ratios. Denaturing gradient gel electrophoresis (DGGE) analysis showed there was no apparent shift in the composition of total bacteria, protozoa and methanogens after treated by gynosaponin under both F:C ratios. The real-time polymerase chain reaction (PCR) analysis indicated that variable F:C ratios significantly affected the abundances of Fibrobacter succinogenes, Rumninococcus flavefaciens, total fungi and counts of protozoa (p<0.05), but did not affect the mcrA gene copies of methanogens and abundance of total bacteria. Counts of protozoa and abundance of F.succinogenes were decreased significantly (p<0.05), whereas mcrA gene copies of methanogens were decreased slightly (p<0.10) in high-forage substrate after treated by gynosaponin. However, gynosaponin treatment under high-concentrate level did not affect the methanogenesis, fermentation characteristics and tested microbes. Accordingly, overall results suggested that gynosaponin supplementation reduced the in vitro methanogenesis and improved rumen fermentation under high-forage condition by changing the abundances of related rumen microbes.


Due to the increased concerns of greenhouse gas emissions and the restriction on the use of the antibiotics in the livestock industry, secondary plant metabolites have received noticeable attention as alternative feed additives to modify the rumen microbial ecosystem and suppress enteric methane emission. Saponins are naturally occurring surface-active glycosides, found in various plants in different forms and structures (Vincken et al., 2007). A great many of studies have been conducted to investigate the effects of different saponins on rumen microbial fermentation characteristics and methanogenesis (Lila et al., 2003; Wina et al., 2005; Guo et al., 2008; Pen et al., 2008). However, the results varied depending on the types, doses and structures of saponins, because saponins have different biological activities according to their aglycone portion and combined sugar body of the structure (Hassan et al., 2010). For example, 0.4 g tea saponins (60% saponins) and 7.01 g Yucca schidigera extract (8% to 10% saponins) in 1 L culture medium reduced the protozoa numbers by 16.4% and 55.9% and methane production by 14.3% and 41.7% respectively (Hu et al., 2005; Pen et al., 2006), whereas 6.91 g Quillaja saponaria extract (5% to 7% saponins) and 0.29 g fenugreek seeds (34% saponins) in 1 L culture medium did not affect the methane production (Pen et al., 2006; Goel et al., 2008a).
Researches have also showed that the effectiveness of saponins on methanogenesis was different depending on the composition of diets. For example, Goel et al. (2008a) noted that methane suppressing effects of saponins from Sesbenia sesban and fenugreek were profound in concentrate-based diets compared with roughage based diets. But, Patra et al. (2006) observed that saponins extracted from Acacia concinna did not affect methane production in 1:1 concentrate to roughage based diet.
Gynostemma pentaphyllum Makino, a perennial creeping herb grown prevalently throughout China, India, Japan and Korea (Blumer and Liu, 1999), is a traditional medicine widely used in the treatment of respiratory inflammation such as cough and chronic bronchitis (Tanner et al., 1999). Its medicinal properties have been mainly attributed to the dammarane saponins with 75% being gynosaponin (Kuwahara et al., 1989). As compared with other saponins, gynosaponin has a high saponin content (>98%) and has been showed effective on methane production, fermentation characteristics and cell numbers in fungus-methanogen co-cultures (Wang et al., 2011). However, the effect of gynosaponin on rumen methane production in a rumen system is not known. Thus, the objective of the present in vitro study was, therefore, to evaluate the effects of gynosaponin addition on rumen methanogenesis, fermentation characteristics and microbiota under different forage-concentrate (F:C) ratios.


Animals and inocula

Three rumen fistulated Nanjing local goats were used for inoculum donor animals. Animals were cared for in accordance with guidelines established by the Chinese Science and Technology Committee Experimental Animal Care and Use guidelines (1998) and the diet was formulated to meet the maintenance requirement (NY/Y 816-2004; Ministry of Agriculture of China, 2004), which included 70% forage (Chinese wildrye) and 30% concentrate mixtures (20% ground corn, 7% soybean meal, 1.5% calcium hydrogen phosphate, 0.5% stone powder, 0.5% sodium chloride, and 0.5% mineral and vitamin premix). Feed was given in equal portions twice daily at 08:00 and 17:00 and the animals had free access to the drinking water. On the day of experiment, rumen contents were collected from three goats just before the morning feeding (0 h) and immediately homogenized and squeezed through two layers of cheesecloth and poured into insulated flasks under anaerobic conditions as described by Zhu et al. (1999) and used as inocula.

Experimental design

Experiment was conducted in a 2×2 double factorial design with substrates Chinese wild rye and concentrate mixture milled to pass through 0.9 mm sieve. The gynosaponin powder, dammarane type triterpene saponin with 98% purity, was from Nanjing Zelang Medical Co. Ltd (China). The culture medium was prepared according to Mao et al. (2007a) using Medium D as defined by Longland et al. (1995). Briefly, micromineral solution 0.1 mL, buffer solution 200 mL, macromineral solution 200 mL, resazurin solution 1 mL and L-cysteine hydrochloride 1 g.
Rumen inocula described above was anaerobically mixed with culture medium, and 60 mL of buffered rumen fluid was then transferred to 160 mL capacity serum bottles that contained 0.6 g total substrate in 7:3 (0.42 g Chinese wild rye, 0.12 g ground corn and 0.06 g soybean meal) and 3:7 (0.18 g Chinese wild rye, 0.28 g ground corn and 0.14 g soybean meal) ratios and with gynosaponin (0 mg and 16 mg). The addition level of gynosaponin was based on previous researches (Hu et al., 2005; Guo et al., 2008; Wang et al., 2011) and the set of serum bottles without gynosaponin was served as control. Each set had four replicates. The serum bottles were sealed with rubber stoppers and aluminum caps and incubated at 39°C for 48 h.

Analytical procedures

Gas and fermentation characteristics

Total gas production was measured at 2, 4, 8, 12, 24, 36, and 48 h of incubation time using a pressure transducer and calibrated syringe (Theodorou et al., 1994). After the total gas measurement, methane production was determined using capillary column gas chromatograph (GC-14B, Shimadzu, Japan), with details as described by Wang et al. (2011). The amount of methane was calculated using standard curves (eight points with triplicate estimations; R2 coefficients of 0.994). After 48 h incubation, the fermentation was terminated by swirling the bottles on ice and the bottles were opened and the pH of rumen samples was determined immediately using a pH meter (Ecoscan pH 5, Singapore), and then the content samples were homogenized and subpackaged to 5 mL centrifuge tubes for further analyses of fermentation characteristics and microbiota. A portion of 5 mL samples was mixed with freshly prepared 25% meta-phosphoric acid for measuring the volatile fatty acids (VFAs) concentrations using a capillary column gas chromatograph (GC-14B, Shimadzu, Japan), with details as described by Mao et al. (2007a). A portion of 5 mL samples was acidified with 0.5 mL 0.5 mol/L HCl and stored at −20°C for further analysis of NH3-N concentration by the indophenols method described by the (Weatherburn, 1967). An aliquot of 5 mL of samples was kept at −20°C for analysis of ruminal microbial crude protein (MCP) concentrations using a colorimetric method, with 1 mg/mL bovine serum albumin solution (Sigma-Aldrich Co. LLC, St. Louis, Missouri, USA) as a standard equivalent, described by Makkar et al. (1982).

DNA extraction

Total DNA was extracted from culture samples according to the method of Denman and McSweeney (2006). Briefly, cetyltrimethyl ammonium bromide buffer was used and followed by Phenol-Chloroform- Isoamyl alcohol extraction (Zhu et al., 2003) and by using equipment FastPrep-24 (MP Biomedical, South Florida, USA) and thermomixer compact.

Microbial communities

Rumen microbial communities were revealed by polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) technique. Primers used to amplify total bacteria, methanogens and protozoa are shown in Table 1. The PCR was performed using a Taq DNA polymerase Kit (Progma, Madison WI, USA) in a thermocycler (Biometra, Göttingen, Germany). PCR program for bacteria was: 94°C for 5 min, and 35 cycles of 94°C for 30 s, 56°C for 20 s, 68°C for 40 s, and 68°C for 7 min last extension; for methanogens was: 94°C for 1 min; 94°C for 30 s, 58°C to 53°C (0.5°C/cycle), 72°C for 1 min 10 cycles, 94°C for 30 s, 56°C for 30 s and 72°C for 1 min 25 cycles, 72°C for 15 min last extension; and for protozoa was: 94°C for 4 min, 56°C for 30 s, 72°C for 1 min, 35 cycles of (56°C for 30 s, 94°C for 1 min and 72°C for 1 min), 94°C for 4 min; 56°C for 30 s and 72°C for 10 min last extension. After checking the sizes and amounts of amplicons using electrophoresis on 1.2% agarose gel containing GoldView, DGGE was performed using a Dcode DGGE system (Bio-Rad, Hercules, California, USA) in 8% polyacrylamide gels containing 37.5:1 acrylamide-biacrylamide and denaturing gradients of 38% to 53%, 40% to 55% and 28% to 43% of urea for bacteria, methanognes and protozoa respectively (Muyzer et al., 1993; Sylvester et al., 2005; Yu et al., 2008). Running progress of electrophoresis, staining, scanning and analyzing the gel electrophoresis profiles were performed by the method as described by Mao et al. (2007b).

Microbial abundances

Samples for protozoa counting were mixed with 9% formaldehyde and preserved at −4°C, then counted in a haemacytometer under light microscope (Nikon YS100, Nikon, Yokohama, Japan) using the method of Dehority (2005). Group-specific primers for methanogens (mcrA), total bacteria and anaerobic fungi, and species-specific primers for R. flavefaciens and F. succinogenes are listed in Table 1, as described by Denman and McSweeney (2006) and Denman et al. (2007). Species of Methanobrevibacter sp. (from CSIRO Livestock Industries, St. Lucia, QLD, Australia), rumen anaerobic fungi isolated from rumen contents by Cheng et al. (2006) and R. flavefaciens and F. succinogenes (from Aberystwyth University, UK) were used to generate standards for real-time PCR analysis. Conventional PCR was performed for respective species and PCR products were quantified using a Nanodrop spectrophotometer ND-1000 UV-Vis (Thermo Fisher Scientific, Inc., Madison, WI, USA). For each standard, copy number concentration was calculated based on the PCR fragment length and the DNA concentration. Real-time quantitative PCR was performed using the ABI 7300 real-time PCR system (Applied Biosystems, Foster, California, USA). Reaction mixture, amplification conditions and performing progresses were conducted by the method of Yang et al. (2012).

Calculation and statistical analysis

Initially, all data were calculated by Microsoft excel software and statistical analysis was carried out using General Linear Model (univariate) procedure of SPSS (version16.0; SPSS Inst. Inc. Cary, NC, USA). When there were statistical changes on the interaction values of treatments, Tukey in the statistical software package SPSS 16.0 was used for further analysis of multiple comparisons of individual treatments.


Total gas, methane production and rumen fermentation characteristics

The cumulative production of total gas and methane during each measuring point are shown in Figure 1A and 1B. The total gas production and methane production showed a similar increasing pattern. However, the total gas production with high-concentrate substrate showed a relatively faster increasing curve than that with high-forage substrate. There was no difference between gyposaponin treatment and the control on cumulative gas production and methane production at each measuring point under high-concentrate substrates. Gynosaponin addition apparently reduced the total gas and methane production from the 4 h of incubation in high-forage substrate. This effect was evident (Table 2) during the 48 h fermentation process, both total gas and methane production of high-concentrate substrate were significantly greater than those of the high-forage substrate. Changes in methane production through gynosaponin treatment were F:C ratio dependent where gynosaponin addition reduced the cumulative methane production by 14.49% (p<0.05) in the high-forage substrate after 48 h fermentation, while no changes were observed in high-concentrate level.
The effects of F:C ratio and gynosaponin treatment on fermentation characteristics are also shown in Table 2. As compared with the high-forage level, under the high-concentrate condition, the pH value and MCP concentration were lower, whereas concentrations of NH3-N and the total and individual VFAs were higher. Gynosaponin treatment increased the pH in both high and low F:C ratios, especially significantly under high-forage condition (p<0.05), but did not affect the concentrations of NH3-N and MCP. Under the high-forage condition, the presence of gynosaponin reduced the acetate concentration (p<0.05), whereas the propionate concentration slightly increased resulting in a significant reduction of acetate propionate ratio (p<0.05). Furthermore, the gynosaponin supplementation increased the butyrate concentrations (p<0.05) in both high and low F:C ratios. Except for the butyrate concentration, however, other individual VFA profiles had no changes after treated by gynosaponin under high-concentrate condition.

Rumen microbial communities

Denaturing gradient gel electrophoresis profiles of bacteria, methanogens and protozoa are shown in Figure 2, 3, and 4, respectively. After 48 h fermentation, in addition to some different bands between two kinds of substrates, no special bands appeared for the composition of total bacteria, protozoa and methanogens after treated by gynosaponin in both high and low F:C ratios.

Rumen microbial abundance

Real-time PCR analysis indicated that (Table 3) variable F:C ratios significantly affected abundances of F. succinogenes, R. flavefaciens, fungi and counts of protozoa, but did not affect the mcrA gene copies of methangens and abundance of total bacteria. Abundance of F. succinogenes and counts of protozoa decreased significantly in high-forage substrate after treated by gynosaponin. The supplementation of gynosaponin also slightly reduced the mcrA gene copies of methanogens (p<0.10) and abundances of total bacteria, fungi and R. flavefaciens under high-forage condition. However, addition of gynosaponin under high-concentrate level did not affect the abundances of above microbes.


Total gas production was closely related to the digestion of fermentation substrates and microbial activity and growth. The high total gas production under high-concentrate ratio might be due to the increased activity of related microbes. The reduction of cumulative total gas production with the high-forage substrate during the 48 h fermentation may be because of the reduced individual gases including methane and VFAs.
Studies have suggested that a high-concentrate diet can modulate the rumen fermentation thereby reducing methane emission. For example, Yan et al. (2000) reported the negative correlation between proportion of concentrate in diet and methane emissions. Similarly, Benchaar et al. (2001) demonstrated that methane production was decreased with the replacement of fibrous concentrate with starchy concentrate by 22% and with the utilization of less ruminally degradable starch by 17%. Compared with the forage based diets, feeding concentrate based diets lowers the enteric methane emission (Johnson and Johnson, 1995), since starch fermentation promotes propionate production and lowers ruminal pH, thereby inhibits protozoa and methanogens (Williams and Coleman, 1988). Aguerre et al. (2011) reported that increasing the F:C ratio increased ruminal pH and methane production, but had no effect on manure NH3-N emission. In our current study however, under the high-concentrate level the total gas and methane emission was greater than the high-forage condition. The most likely reason for this was high-concentrate conditions can offer more fermentable substrates for bacteria and methanogens, thus producing more H2 and or formic acid and acetate, leading to more methane, since H2, formic acid and acetate are effective methanogenic substrates (Bauchop and Mountfort, 1981). In addition, in vitro studies though valuable, may not reflect the real activity of diets in the rumen. Indeed, total and individual VFAs were increased with high-concentrate level as compared with high-forage level (Table 2).
The addition of gynosaponin showed no effect on methane production under high concentrate conditions. However, supplementation of gynosaponin inhibited methane production by14.49% under high-forage condition. A great many of in vitro researches were conducted to investigate the effects of various saponins on rumen methane production under different F:C ratios. Holtshausen et al. (2009) noted that during in vitro 24 h fermentation Quillaja saponaria 0.75 g/L in forage based (F:C = 51:49) substrate decreased the methane production by 11.4% and Lila et al. (2003) observed that sarsaponin 1.2 g/L in forage based (F:C = 1.5:1) substrate decreased the methane production by 13.5%. However, Pen et al. (2006) reported that Quillaja saponaria extract 2.3 g/L in F:C = 1:1 substrate did not affect methane production. Goel et al. (2008a) demonstrated that methane suppressing effects of saponins from Sesbenia sesban and fenugreek were pronounced in concentrate-based diets comparing with roughage based diets. All inconsistencies among above the studies about effects of saponins on methane production may have been due to many factors including the types, doses and structures of saponins and composition of diets (Beauchemin et al., 2008).
Microbial protein, pH value, ammonia-nitrogen and variable VFAs are important rumen inner environmental parameters. In this study, gynosaponin addition increased the pH value under both high and low F:C ratios, especially under high-forage level, but did not affect the MCP and NH3-N concentrations. The effects of saponins on rumen pH values were various, with some studies showing a reduction (Goetsch and Owens, 1985; Wu et al., 1994), while other studies showed an increase (Wang et al., 2011) or no effect (Hussain and Cheeke, 1995; Hristov et al., 1999) after treatment with saponins. Consistent with our study, Hristov et al. (1999) reported that Yucca schidigera extract had no significant effect on microbial protein and Mao et al. (2010) reported that amino-nitrogen concentration was little affected by tea saponin addition.
Coupled with the change of methane emission, our results showed that under a high-forage condition, gynosaponin addition significantly reduced acetate concentration, while slightly increased propionate proportion, thereby resulting in a significant reduction of A: P ratio. This was in agreement with in vitro observations of Wina et al. (2005) and Staerfl et al. (2010) that the acetate proportion was reduced significantly by Yucca saponins and methanol extract of Sapindus rarak addition respectively. Wang et al. (2011) also found the reduction of acetate concentration after treated by gynosaponin in a fungus-methanogen co-culture system. In addition, consistent with our results, increased propionate concentrations and considerably reduced A:P ratios appeared to be achieved in several in vitro (Lila et al., 2003; Wina et al., 2005; Pen et al., 2006; 2008) studies. Patra et al. (2010) concluded that saponins might increase the propionate production as a result of rechannelling of hydrogen from methane to propionate and decrease the A:P ratio, which is nutritionally beneficial for ruminants. Mao et al. (2010) reported that methane-suppressing effects of saponins could lead to hydrogen accumulation. However, the high partial pressure of hydrogen and high NADH/NAD+ ratio in the rumen due to the inhibition of methanogenesis may result in a decrease of acetate production (Miller, 1995). Except for the above change in VFA proportions, a slight increase of total VFA concentration was also observed related to the gynosaponin addition under high-forage substrate. Accordingly, the increased pH value in our study might be due to the reduction of the VFAs concentrations in high-forage level. In addition, increased butyrate concentration of treatment groups in both high and low F:C ratios were found in this experiment. But, the mechanism causing the increased butyrate concentration after treated by gynosaponin will need further research.
With DGGE patterns, there were some different bands between two kind substrates, but no special bands appeared for the composition of total bacteria, protozoa and methanogens after treated by gynosaponin in both F:C ratios. This may suggest that gynosaponin treatment did not have an affect the microbiota in the rumen. Possibly due to sufficient fibrous materials offered for the fiber degrading microbes, the abundances of F. succinogens, R. flavefaciens, fungi and counts of protozoa were significantly increased under high-forage conditions as compared with the high-concentrate substrates. Inclusion of gynosaponin in high-forage substrate significantly reduced the counts of protozoa and abundance of F. succinogenes, also slightly reduced the mcrA gene copies of methanogens and abundances of total bacteria, fungi and R. flavefaciens. However, addition of gynosaponin to the high-concentrate level did not affect the abundances of above microbes.
Most studies (Moss et al., 2000; Hu et al., 2005; Goel et al., 2008b) found the methane inhibitory effects of variable saponins and these authors contributed this to reduction in protozoa numbers, since protozoa have a symbiotic association with methanogens (Finlay et al., 1994) and methanogens associated with protozoa accounted for as much as 37% decreased methane production (Bhatta et al., 2009). A strong association of protozoal number and methanogenesis was evident in this experiment and this association seemed to be F:C dependent. Gynosaponin substantially reduced the protozoa numbers and methane production in high-forage substrate, but showed little effect on methane production with high-concentrate substrate. In high-concentrate substrate, protozoa counts were significantly lower than the high-forage condition, thus gynosaponin addition to high-concentrate substrate may not show evident effects on protozoa. In the high-forage substrate however, gynosaponin inhibited the protozoa counts. Thus, it is possible that when protozoa counts were higher, the effect of saponins would be more profound.
Indeed, in our present study methanogens, fungi, F. succinogenes and R.flavefaciens were less abundant after treated by gynosaponin under high-forage substrate. Several in vitro studies have reported the direct inhibitory effects of saponins on methanogens. As Goel et al. (2008b) and Wang et al. (2011) noted that saponins significantly reduced methane concentration and inhibited the methanogen growth. Accordant with our results, Wina et al. (2005) observed the toxicity of feeding saponins at high levels occurred to protozoa, fungi and bacteria. Wang et al. (2011) reported that growth of the fungus was decreased by high level gynosaponin addition. Wang et al. (2000) demonstrated that abundances of F. succinogenes and R. flavefaciens were negatively affected by high level of saponins. Lu and Jorgensen (1987) and Wang et al. (2000) reported that fiber degrading bacteria were more sensitive to saponins than starch degrading bacteria. This may partly explain the current finding that the fibre-degrading bacterial species were evidently affected while the total bacterial population was less affected.
Since Wallace et al. (1994) reported that purified saponins were toxic to rumen microorganisms, the inhibitory effect of gynosaponin on tested microorganisms could be due to its high saponin content as the gynosaponin used in our experiment contained 98% high saponin purity. Furthermore, Saponins have sterol-binding capability in protozoa and fungi cell membranes (Bodas et al., 2008). Wang et al. (2012) demonstrated that expression of mcrA gene is closely related to the activity of methanogens and methane production. Thus, the slight reduction of mcrA gene copies of methanogens in our study indicates a lowered activity of methanogens. However, the mechanism behind the reduction of methanogens related to saponins is still not yet clear. Further research is needed to elucidate the underlying mechanism.


Gynosaponin supplementation inhibited the rumen in vitro methane production in high-forage conditions by changing fermentation characteristics and the abundance of related microbes.



Bakhetgul Manatbay conducted animal experiment, performed DGGE and q-PCR, analyzed the data and drafted the manuscript. Yanfen Cheng helped with methane measurement, DGGE and q-PCR. Shengyong Mao helped with experiment design and statistical analysis. Weiyun Zhu conceived this study, finalized the manuscript and revised the manuscript. We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.


This work was supported by the National Natural Science Foundation of China (31072052) and China (MOST) – Australia (IIST) joint project (2010DFA31040). The authors thank Dr Christopher S. McSweeney (CSIRO Livestock Industries, Australia) for providing Methanobrevibacter and Dr Eun Joong Kim (Aberystwyth University, UK) for R. flavefaciens and F. succinogenes.

Figure 1
Curves of cumulative gas production (A) and methane production (B). HF+0 mg = high forage (F:C = 70:30)+0 mg gynosaponin; HF+16 mg = high-forage (F:C = 70:30)+16 mg gynosaponin; HC+0 mg = High-concentrate (F:C = 30:70)+0 mg gynosaponin; HC+16 mg = high concentrate (F:C = 30:70)+16 mg gynosaponin. Values presented are the average of the replicate cultures (n = 4). Error bars represent the standard error of the mean.
Figure 2
Denaturing gradient gel electrophoresis profile of ruminal bacteria. HF+0 mg = high forage (F:C = 70:30)+0 mg gynosaponin; HF+16 mg = high-forage (F:C = 70:30)+16 mg gynosaponin; HC+0 mg = High-concentrate (F:C = 30:70)+0 mg gynosaponin; HC+16 mg = High concentrate (F:C = 30:70)+16 mg gynosaponin, B1, B2, B3, B4; replications.
Figure 3
Denaturing gradient gel electrophoresis profile of ruminal methanogens. HF+0 mg = high forage (F:C = 70:30)+0 mg gynosaponin; HF+16 mg = high-forage (F:C = 70:30)+16 mg gynosaponin; HC+0 mg = high-concentrate (F:C = 30:70)+0 mg gynosaponin; HC+16 mg = high concentrate (F:C = 30:70)+16 mg gynosaponin. M1, M2, M3, M4; replications.
Figure 4
Denaturing gradient gel electrophoresis profile of ruminal protozoa. HF+0 mg = high forage (F:C = 70:30)+0 mg gynosaponin; HF+16 mg = high-forage (F:C = 70:30)+16 mg gynosaponin; HC+0 mg = high-concentrate (F:C = 30:70)+0 mg gynosaponin; HC+16 mg = high concentrate (F:C = 30:70)+16 mg gynosaponin, P1, P2, P3, P4; replications.
Table 1
Primers used for DGGE and Real-time PCR
Target organisms Primers Sequence (5′→3′) Amplicon
Total bacteria 968F-GC AACGCGAAGAACCTTAC 433 Nübel et al. (1996)
Methanogens 344F-GC ACGGGGYGCAGCAGGCGCGA 175 Yu ZT et al. (2008)
Protozoa 316F GCTTTCGWTGGTAGTGTATT 223 Sylvester et al. (2005)
Methanogens Forward TTCGGTGGATCDCARAGRGC 140 Denman et al. (2007)
Total bacteria Forward CGGCAACGAGCGCAACCC 130 Denman and McSweeny (2006)
Fungi Forward GAGGAAGTAAAAGTCGTAACAAGGTTTC 120 Denman and McSweeny (2006)
R. flavefaciens Forward CGAACGGAGATAATTTGAGTTTACTTAGG 132 Denman et al. (2007)
F. succinogenes Forward GTTCGGAATTACTGGGCGTAAA 121 Denman and McSweeny (2006)

DGGE, denaturing gradient gel electrophoresis; PCR, polymerase chain reaction.


Table 2
Effects of gynosaponin on in vitro rumen 48 h fermentation characteristics at different F:C ratios
Item Treatment1 (mg gynosaponin)
SEM p-value2
HF+0 HF+16 HC+0 HC+16 F:C GS F:C×GS
Gas production (mL) 111.34a 104.76b 135.34c 134.64c 1.80 <0.01 0.05 0.15
Methane (mmol) 0.727a 0.625b 0.950c 0.954c 0.019 <0.01 0.02 <0.01
pH value 6.54a 6.59b 6.36c 6.40d 0.01 <0.01 0.01 0.25
MCP (mg/mL) 0.32 0.32 0.31 0.30 0.00 <0.01 0.13 0.10
NH3-N (mmol/L) 12.39a 13.23a 16.27b 16.77b 0.98 <0.01 0.51 0.86
TVFA (mmol/L) 74.65a 72.43a 88.81b 91.50b 1.74 <0.01 0.90 0.18
Acetate (mmol/L) 46.54a 41.11b 50.37c 51.40c 1.12 <0.01 0.02 0.01
Propionate (mmol/L) 12.71a 13.75b 14.32bc 14.7c 0.45 0.01 0.14 0.48
Butyrate (mmol/L) 7.91a 9.72b 13.70c 15.12c 0.57 <0.01 0.04 0.74
Valerate (mmol/L) 1.97a 2.05a 3.38b 2.87b 0.25 <0.01 0.42 1.97
Isobutyrate (mmol/L) 2.45a 2.49a 2.97 ab 3.13b 0.19 0.01 0.60 0.76
Isovalerate (mmol/L) 3.07a 3.32a 4.06b 4.26b 0.18 <0.01 0.23 0.90
A:P ratio 3.70a 2.99b 3.52ab 3.50ab 0.13 0.24 0.02 0.02

F:C ratios, forage-concentrate ratios; SEM, standard error of means; MCP, microbial crude protein; TVFA, total volatile fatty acid.

1 HF+0 mg = high forage (F:C = 70:30)+0 mg gynosaponin; HF+16 mg = high-forage (F:C = 70:30)+16 mg gynosaponin; HC+0 mg = high-concentrate (F:C = 30:70)+0 mg gynosaponin; HC+16 mg = high concentrate (F:C = 30:70)+16 mg gynosaponin.

2 F:C = effects of forage concentrate ratios; GS = effects of gynosaponin; F:C×GS = interaction effects of forage concentrate ratios and gynosaponin.

a,b,c The means within a row with different superscripts differ significantly (p<0.05).

Table 3
In vitro effects of gynosaponin on rumen microbial population after 48 h incubation at different F:C ratios
Item (copies/mL) Treatment1 (mg)
SEM p-value2
HF+0 HF+16 HC+0 HC+16 F:C GS F:C×GS
Bacteria (×1010) 1.37 1.27 1.23 1.23 0.05 0.08 0.30 0.31
Methanogen (×107) 9.12 8.40 9.20 9.11 0.22 0.09 0.09 0.17
Fungi (×105) 2.37a 2.16a 1.83b 1.86b 0.10 <0.01 0.19 0.12
F. succinogenes (×107) 1.04a 0.86b 0.38c 0.29c 0.05 <0.01 0.02 0.37
R. flavefaciens (×107) 2.62a 2.49a 1.44b 1.65b 0.11 <0.01 0.76 0.17
Protozoa (×103) 8.95a 7.85b 6.95c 6.70c 0.27 <0.01 0.03 0.15

F:C ratios, forage-concentrate ratios; SEM, standard error of means.

1 HF+0 mg = high forage (F:C = 70:30)+0 mg gynosaponin; HF+16 mg = high-forage (F:C = 70:30)+16mg gynosaponin; HC+0 mg = high-concentrate (F:C = 30:70)+0 mg gynosaponin; HC+16 mg = high concentrate (F:C = 30:70)+16 mg gynosaponin.

3 F:C = effects of forage concentrate ratios; GS = effects of gynosaponin; F:C×GS = interaction effects of forage concentrate ratios and gynosaponin.

a,b,c The means within a row with different superscripts differ significantly (p<0.05).


Aguerre MJ, Wattiaux MA, Powell JM, Broderick GA, Arndt C. 2011. Effect of forage to concentrate ratio in dairy cow diets on emission of methane, carbon dioxide, and ammonia, lactation performance, and manure excretion. J Dairy Sci 94:3081–3039.
crossref pmid
Bauchop T, Mountfort DO. 1981. Cellulose fermentation by a rumen anaerobic fungus in both the absence and the presence of rumen methanogens. Appl Environ Microbiol 42:1103–1110.
pmid pmc
Beauchemin K, Kreuzer M, O’mara F, McAllister T. 2008. Nutritional management for enteric methane abatement: A review. Anim Prod Sci 48:21–27.
Benchaar C, Pomar C, Chiquette J. 2001. Evaluation of dietary strategies to reduce methane producion in ruminants: A modelling approach. Can J Anim Sci 81:563–574.
Bhatta R, Uyeno Y, Tajima K, Takenaka A, Yabumoto Y, Nonaka I, Enishi O, Kurihara M. 2009. Difference in the nature of tannins on in vitro ruminal methane and volatile fatty acid production and on methanogenic archaea and protozoal populations. J Dairy Sci 92:5512–5522.
crossref pmid
Blumer M, Liu JL. 1999. Jiaogulan in China’s “Immortalit Herb”,”. Torchlight Pubishing Inc; Badger, USA:

Bodas R, López S, Fernández M, García-González R, Rodríguez AB, Wallace RJ, González JS. 2008. In vitro screening of the potential of numerous plant species as antimethanogenic feed additives for ruminants. Anim Feed Sci Technol 145:245–258.
Cheng YF, Mao SY, Pei CX, Liu JX, Zhu WY. 2006. Detection and diversity analysis of rumen methanogens in the co-cultures with anaerobic fungi. Acta Microbiol Sin 46:879–883.

Dehority BA. 2005. Ciliate protozoa. Methods in Gut Microbial Ecology for Ruminants. Makkar HPS, McSweeney CS, editorsIAEA; Netherlands: p. 67–78.
Denman SE, McSweeney CS. 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol Ecol 58:572–582.
crossref pmid
Denman SE, Tomkins NW, McSweeney CS. 2007. Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiol Ecol 62:313–322.
crossref pmid
Finlay BJ, Esteban G, Clarke KJ, Williams AG, Embley TM, Hirt RP. 1994. Some rumen ciliates have endosymbiotic methanogens. FEMS Microbiol Lett 117:157–161.
crossref pmid
Goel G, Makkar HPS, Becker K. 2008a. Effect of Sesbania sesban and Carduus pycnocephalus leaves and fenugreek seeds (Trigonella foenum-graecum L.) and their extracts on partitioning of nutrient from roughage and concentrate based feeds to methane. Anim Feed Sci Technol 147:72–89.
Goel G, Makkar HP, Becker K. 2008b. Changes in microbial community structure, methanogenesis and rumen fermentation in response to saponin-rich fractions from different plant materials. J Appl Microbiol 105:770–777.
Goetsch AL, Owens FN. 1985. Effects of sarsaponin on digestion and passage rates in cattle fed medium to low concentrate. J Dairy Sci 68:2377–2384.
crossref pmid
Guo YQ, Liu JX, Lu Y, Zhu WY, Denman SE, McSweeney CS. 2008. Effect of tea saponin on methanogenesis, microbial community structure and expression of mcrA gene, in cultures of rumen micro-organisms. Lett Appl Microbiol 47:421–426.
crossref pmid
Hassan SM, Byrd JA, Cartwright AL, Bailey CA. 2010. Hemolytic and antimicrobial activities differ among saponin-rich extracts from guar, quillaja, yucca, and soybean. Appl Biochem Biotechnol 162:1008–1017.
crossref pmid
Holtshausen L, Chaves AV, Beauchemin KA, McGinn SM, McAllister TA, Odongo NE, Cheeke PR, Benchaar C. 2009. Feeding saponin-containing Yucca schidigera and Quillaja saponaria to decrease enteric methane production in dairy cows. J Dairy Sci 92:2809–2821.
crossref pmid
Hristov AN, McAllister TA, Van Herk FH, Cheng KJ, Newbold CJ, Cheeke PR. 1999. Effect of Yucca schidigera on ruminal fermentation and nutrient digestion in heifers. J Anim Sci 77:2554–2563.
crossref pmid
Hu WL, Liu JX, Ye JA, Wu YM, Guo YQ. 2005. Effect of tea saponin on rumen fermentation in vitro. Anim Feed Sci Technol 120:333–339.
Hussain I, Cheeke PR. 1995. Effect of dietary Yucca Schidigera extract on rumen and blood profiles of steers fed concentrate-or roughage-based diets. Anim Feed Sci Technol 51:231–242.
Johnson KA, Johnson DE. 1995. Methane emissions from cattle. J Anim Sci 73:2483–2492.
crossref pmid
Kuwahara M, Kawanishi F, Komiya T, Oshio H. 1989. Dammarane saponins of Gynostemma pentaphylum Makino and isolation of malonylginsenosides-Rb1, -Rd, and malonylgypenoside V. Chem Pharm Bull 37:135–139.
Lila ZA, Mohammed N, Kanda S, Kamada T, Itabashi H. 2003. Effect of sarsaponin on ruminal fermentation with particular reference to methane production in vitro. J Dairy Sci 86:3330–3336.
crossref pmid
Longland AC, Theodorou MK, Sanderson R, Lister SJ, Powell CJ, Morris P. 1995. Non-starch polysaccharide composition and in vitro fermentability of tropical forage legumes varying in phenolic content. Anim Feed Sci Technol 55:161–177.
Lu CD, Jorgensen NA. 1987. Alfalfa saponins affect site and extent of nutrient digestion in ruminants. J Nutr 117:919–927.
crossref pmid
Makkar HP, Sharma OP, Dawra RK, Negi SS. 1982. Simple determination of microbial protein in rumen liquor. J Dairy Sci 65:2170–2173.
crossref pmid
Mao HL, Wang JK, Zhou YY, Liu JX. 2010. Effects of addition of tea saponins and soybean oil on methane production, fermentation and microbial population in the rumen of growing lambs. Livest Sci 129:56–62.
Mao SY, Zhu WY, Wang QJ, Yao W. 2007a. Effect of daidzein on in vitro fermentation of micro-organisms from the goat rumen. Anim Feed Sci Technol 136:154–163.
Mao SY, Zhang G, Zhu WY. 2007b. Effect of disodium fumarate on in vitro rumen fermentation of different substrates and rumen bacterial communities as revealed by denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA. Asian Australas. J Anim Sci 20:543–549.

Miller TL. 1995. Ecology of methane production and hydrogen sinks in the rumen. Ruminant Physiology: Digestion, Metabolism, Growth and Reproduction. Engelhardt W, Leonhard-Marek S, Breves G, Giesecke D, Enke V Ferdinand, editorsStuttgart, Germany: p. 317–331.

Moss AR, Jouany JP, Newbold J. 2000. Methane production by ruminants: its contribution to global warming. Ann Zootech 49:231–253.
Muyzer G, de Waal EC, Uitterlinden AG. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59:695–700.
pmid pmc
Patra A, Kamra D, Agarwal N. 2006. Effect of plant extracts on in vitro methanogenesis, enzyme activities and fermentation of feed in rumen liquor of buffalo. Anim Feed Sci Technol 128:276–291.
Patra AK, Kamra DN, Agarwal N. 2010. Effects of extracts of spices on rumen methanogenesis, enzyme activities and fermentation of feeds in vitro. J Sci Food Agric 90:511–520.
crossref pmid
Pen B, Sar C, Mwenya B, Kuwaki K, Morikawa R, Takahashi J. 2006. Effects of Yucca schidigera and Quillaja saponaria extracts on in vitro ruminal fermentation and methane emission. Anim Feed Sci Technol 129:175–186.
Pen B, Sar C, Mwenya B, Takahashi J. 2008. Effects of Quillaja saponaria extract alone or in combination with Yucca schidigera extract on ruminal fermentation and methanogenesis in vitro. Anim Sci J 79:193–199.
Staerfl SM, Kreuzer M, Soliva CR. 2010. In vitro screening of unconventional feeds and various natural supplements for their ruminal methane mitigation potential when included in a maize-silage based diet. J Anim Feed Sci 19:651–664.
Sylvester JT, Karnati SKR, Yu Z, Newbold CJ, Firkins JL. 2005. Evaluation of a real-time PCR assay quantifying the ruminal pool size and duodenal flow of protozoal nitrogen. J Dairy Sci 88:2083–2095.
crossref pmid
Tanner MA, Bu X, Steimle JA, Myers PR. 1999. The direct release of nitric oxide by gypenoside derived from the herb Gynostemma pentaphyllm. Nitric Oxide 3:359–365.
crossref pmid
Theodorou MK, Williams BA, Dhanoa MS, McAllan AB, France J. 1994. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim Feed Sci Technol 48:185–197.
Vincken JP, Heng L, de Groot A, Gruppen H. 2007. Saponins, classification and occurrence in the plant kingdom. Phytochemistry 68:275–297.
crossref pmid
Wallace RJ, Arthaud L, Newbold CJ. 1994. Influence of Yucca shidigera extract on ruminal ammonia concentrations and ruminal microorganisms. Appl Environ Microbiol 60:1762–1767.
pmid pmc
Wang JK, Ye JA, Liu JX. 2012. Effects of tea saponins on rumen microbiota, rumen fermentation, methane production and growth performance—A review. Trop Anim Health Prod 44:697–706.
crossref pmid
Wang X, Mao S, Liu J, Zhang L, Cheng Y, Jin W, Zhu W. 2011. Effect of gynosaponins on methane production and microbe numbers in a fungus-methanogen co-culture. J Anim Feed Sci 20:272–284.
Wang Y, McAllister TA, Yanke LJ, Cheeke PR. 2000. Effect of steroidal saponin from Yucca schidigera extract on ruminal microbes. J Appl Microbiol 88:887–896.
crossref pmid
Weatherburn M. 1967. Phenol-hypochlorite reaction for determination of ammonia. Anal Chem 39:971–974.
Williams AG, Coleman GS. 1988. The rumen protozoa. The Rumen Microbial Ecosystem. Hobson PN, Stewart CS, editorsSpringer; New York, USA: p. 77–129.
Wina E, Muetzel S, Hoffmann E, Makkar H, Becker K. 2005. Saponins containing methanol extract of Sapindus rarak affect microbial fermentation, microbial activity and microbial community structure in vitro. Anim Feed Sci Technol 121:159–174.
Wu Z, Sadik M, Sleiman FT, Simas JM, Pessarakli M, Huber JT. 1994. Influence of yucca extract on ruminal metabolism in cows. J Anim Sci 72:1038–1042.
crossref pmid
Yang CJ, Mao SY, Long LM, Zhu WY. 2012. Effect of disodium fumarate on microbial abundance, ruminal fermentation and methane emission in goats under different forage: concentrate ratios. Animal 6:1788–1794.
crossref pmid
Yan T, Agnew R, Gordon F, Porter M. 2000. Prediction of methane energy output in dairy and beef cattle offered grass silage-based diets. Livest Prod Sci 64:253–263.
Yu Z, Garcia-Gonzalez R, Floyd L, Schanbacher , Morrison M. 2008. Evaluations of different hypervariable regions of archaeal 16S rRNA genes in profiling of methanogens denaturing by Archaea-specific PCR and gradient gel electrophoresis. Appl Environm Microbiol 74:889–893.
crossref pmid pmc
Zhu WY, Kingston-Smith AH, Troncoso D, Merry RJ, Davies DR, Pichard G, Thomas H, Theodorou MK. 1999. Evidence of a role for plant proteases in the degradation of herbage proteins in the rumen of grazing cattle. J Dairy Sci 82:2651–2658.
crossref pmid
Zhu WY, Williams BA, Konstantinov SR, Tamminga S, de Vos WM, Akkermans ADL. 2003. Analysis of 16S rDNA reveals bacterial shift during in vitro fermentation of fermentable carbohydrate using piglet faeces as inoculum. Anaerobe 9:175–180.
crossref pmid

Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : jongkha@hotmail.com               

Copyright © 2019 by Asian-Australasian Journal of Animal Sciences. All rights reserved.

Close layer
prev next