Genetic Diversity of Myanmar and Indonesia Native Chickens Together with Two Jungle Fowl Species by Using 102 Indels Polymorphisms

Article information

Asian-Australas J Anim Sci.. 2012;25(7):927-934
2Faculty of Agriculture, Kagoshima University, Kagoshima 890-0065, Japan.
3Frontier Science Research Centre, Kagoshima University, Kagoshima 890-0065, Japan.
4Faculty of Agriculture, University of the Ryukyus 903-0213, Japan.
*Corresponding Author: Shin Okamoto. Tel: +81-99-285-8589, Fax: +81-99-285-8589, E-mail: chacha@agri.kagoshima-u.ac.jp
1

United Graduate School of Agricultural Science, Kagoshima University, Kagoshima 890-0065, Japan

Received 2011 December 26; Accepted 2012 March 15; Revised 2012 April 03.

Abstract

The efficiency of insertion and/or deletion (indels) polymorphisms as genetic markers was evaluated by genotyping 102 indels loci in native chicken populations from Myanmar and Indonesia as well as Red jungle fowls and Green jungle fowls from Java Island. Out of the 102 indel markers, 97 were polymorphic. The average observed and expected heterozygosities were 0.206 to 0.268 and 0.229 to 0.284 in native chicken populations and 0.003 to 0.101 and 0.012 to 0.078 in jungle fowl populations. The coefficients of genetic differentiation (Gst) of the native chicken populations from Myanmar and Indonesia were 0.041 and 0.098 respectively. The genetic variability is higher among native chicken populations than jungle fowl populations. The high Gst value was found between native chicken populations and jungle fowl populations. Neighbor-joining tree using genetic distance revealed that the native chickens from two countries were genetically close to each other and remote from Red and Green jungle fowls of Java Island.

INTRODUCTION

Nowadays, it is increasingly recognized that insertion and deletion (indels) polymorphisms are an important source of genetic as well as phenotypic diversity (Brandström and Ellegren, 2007). Indels can be genotyped with simple procedures based on size separation as compared to complex and heterogenous mutation patterns of microsatellites and without the necessity of applying special equipment for high-throughput genotyping that is relatively costly for small or medium scale studies using microsatellite and SNP markers (Väli et al., 2008). Moreover, indels markers have many genetic advantages for analytical use: they are widely spread throughout the genome, all of the polymorphisms derive from a single mutation event and they have reduced mutation rates (Natalle et al., 2010). It was reported that the draft sequence of the chicken genome was composed of approximately 1.2 Gb which included 447,388 indels polymorphisms (2011, November) in the National Center for Biotechnology Information (NCBI) Entrez SNP database (www.ncbi.nih.gov/sites/entrez?db=snp). This clearly indicated that indels could form a very common class of polymorphism over the chicken genome and might be important genetic markers. The present study focused on indels polymorphisms as genetic markers for studying genetic diversity in chicken population.

Chickens are good models for studying the genetic basis of phenotypic traits because of the extensive diversity among domestic chickens (Wong et al., 2004). There are more than 18 million stocks of chickens being raised in the world (FAO Statistics, 2009). Native chickens, as the most adaptable and geographically widespread livestock species, form an integral part of the Myanmar and Indonesian ecosystem. Native chickens possess unique adaptive traits that permit them to survive and reproduce under harsh climatic, nutritional and management conditions typically associated with low input-output production systems (Mwacharo et al., 2006).

Myanmar is the largest country on main land South East Asia with a total land area of 676,577 sq Km. Myanmar possesses tropical and sub tropical climates and rich with diverse species of animal and wild relatives of livestock. Latest estimates indicate that there are 105 million domesticated birds raised in Myanmar, out of which 94 million are chicken, mostly 78.7 million birds (84%) kept under backyard production systems (Burgos et al., 2009).

The land area of Indonesia covers 1,919,445 sq Km, spreading from Aceh Province in the north west of Sumatra to the Western part of Papua. It is a large tropical island in South East Asia, which shelters a large number and variety of wild as well as domesticated animals. According to livestock statistic from 2007, Indonesia has an estimated standing population of 620 million chickens which include 317 million native/village chicken (51%) kept by rural farmers (Ministry of Agriculture -2007 cited by Bambang et al., 2009).

Although these native chickens are not available for commercial use, they are raised as dual- purpose for meat and eggs, providing cash income in times of need. It is interesting to examine the genetic variability among native chicken from two south East Asia countries using molecular markers. Therefore, the present study was conducted to evaluate the indels polymorphisms as genetic markers to characterize the genetic variability of the native chicken populations from Myanmar and Indonesia and to determine the genetic relationship among Myanmar and Indonesia native chicken populations and two jungle fowl species.

MATERIALS AND METHODS

In the present study, we used 11 native chicken populations and two jungle fowl species. In Myanmar native chickens, we analyzed three populations from Yangon (Yan) and Pegu (Peg) of lower Myanmar and from Mandalay (Man) of central Myanmar. In Indonesian native chicken, we analyzed four populations of local chicken and four populations of local varieties: The local chicken populations were collected from Semarang (Sem), Kendal (Ken), Yogyakarta region (Yog) of the central Java, and Karawang region (Kar) of west Java. The populations of local varieties were Ayam Kedu (AK) from Temanggun (AK-Tem) and Solo (AK-Sol) of the central Java, Black Kedu (BK) from Semarang (BK-Sem) and Ayam Alab (AA) from Temanggun (AA-Tem). Two jungle fowls species from Java, Red jungle fowl (Gallus gallus bankiva, RJF) and Green jungle fowl (Gallus varius, GJF) were also examined. Blood samples were obtained from Yan (n = 27), Peg (n = 13), Man (n = 40), Sem (n = 24), Ken (n = 40), Yog (n = 57), Kar (n = 15), AK-Tem (n = 10), AK-Sol (n = 19), BK-Sem (n = 23), AA-Tem (n = 20), RJF (n = 3), GJF (n = 6) respectively.

Genomic DNA was extracted from blood samples using standard phenol-chloroform extraction protocols (Sambrook, 1989). Suitable indels markers were selected by using the NCBI Entrez SNP database. The primer sequences used in this study were listed in Table 1.

Summary of primer sequences for 102 indels loci

In primer design, indels sequences of 20 to 30 bp along the every 10 Mb of chromosome length were selected. The PCR amplifications were performed in a 10 μl reaction volume, which included 6.15 μl of distilled water, 1 μl of 10× reaction buffer, 0.8 μl of dNTP (2.5 mM), 0.25 units of Ex Taq™ (Takara Bio Inc, Otsu, Japan), 10 ng of template DNA, 25 μM each of forward and reverse primers. The PCR reaction was performed with an initial denaturation for 2 min at 94°C followed by 28 to 32 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 48 to 65°C and extension for 30 s at 72°C and final extension for 7 min at 72°C in Takara PCR thermal cycler - TP650 (Takara Bio Inc). The PCR products and a 100 bp DNA ladder (Sib Enzyme Ltd, Russia) were electrophoresed on 1 to 2% agarose gel electrophoresis in 1×TBE. The indel polymorphisms were identified through a Toyobo FAS III UV-Transilluminator (Toyobo, Osaka, Japan) after ethidium bromide staining for 15 to 30 min. Genotypes of indel polymorphisms were determined by size difference between the PCR fragments.

Statistical analysis

We calculated allele frequencies from genotyping data by direct counting. The proportion of polymorphic loci (Ppoly) was calculated as the ratio of polymorphic loci to the total number of loci analyzed. Chi square (χ2) approximation was used to test Hardy-Weinberg Equilibrium (HWE) at each locus (Weir, 1996). To estimate the genetic variability, we calculated the average observed heterozygosity (H¯O), the average expected heterozygosity (H¯E) of each population and degree of genetic differentiation (Gst) (Nei, 1973). H¯E was estimated by Nei’s formula (Nei, 1978). To assess the genetic relationships between 13 populations, pair wise standard genetic distance (Ds) (Nei, 1972) was computed using PHYLIP ver. 3.69 (Felsenstein, 2009). From the data of the genetic distance matrix, we constructed phylogenetic tree by using neighbor- joining (NJ) method (Saitou and Nei, 1987) implemented by MEGA software ver.4.1 (Tamura et al., 2007).

RESULTS

Indels polymorphisms

The mean (±SE) Ppoly value of each population is listed in Table 2. Out of 102 indels markers, 97 markers (Ppoly = 95%) were polymorphic in native chicken populations, all of which were in HWE (Table 1). The Ppoly was higher in Indonesian native chicken populations (Ppoly = 94%) than Myanmar native chicken populations (Ppoly = 92%) (Table 2). One marker (m 66) was monomorphic only in Indonesian native chicken populations whereas three markers (m 11, m 33 and m 92) were monomorphic only in Myanmar native chicken populations.

The genetic variability from 13 populations of native chickens and two jungle fowl species

In two jungle fowl species, RJF showed more polymorphic loci (22 markers, Ppoly = 21%) than GJF (4 markers, Ppoly = 3.9%) (Table 2).

Genetic variability

The H¯O and H¯E values ranged from 0.206 to 0.268 and from 0.229 to 0.284 in 11 native chicken populations (Table 2). In the jungle fowls, RJF showed higher H¯O and H¯E values (0.101 and 0.078) than GJF (0.003 and 0.012). Among the Myanmar and Indonesian native chickens, the Gst value was 0.041 for Myanmar and 0.098 for Indonesia (Table 3). The two jungle fowl species showed the highest genetic differentiation between them with Gst value of 0.436. The Gst observed between two jungle fowl species and Myanmar native chicken (0.213 to RJF and 0.264 to GJF) was higher than the Gst between two jungle fowl species and Indonesian native chicken (0.162 to RJF and 0.186 to GJF). The Gst among 13 populations was calculated as 0.227.

Coefficient of genetic differentiation (Gst) in various subsets of 13 populations of native chickens and two jungle fowl species estimated from 102 indels loci

Genetic distance and phylogenic analysis

The Ds distances are shown in Table 4. The Ds distances between the native chicken populations ranged from 0.034 to 0.078 within Myanmar, from 0.009 to 0.147 within Indonesia and from 0.063 to 0.200 between the two countries.

Pair wise genetic distance matrix between 13 populations of native chickens and two jungle fowl species

The smallest (0.063) was observed between the Ken and Yan population and between the Yan and Yog populations. The largest (0.200) was obtained from between BK-Sem and Peg populations. The genetic distances between native chicken populations and the two jungle fowl species ranged from 0.247 to 0.405.

The NJ tree constructed from the Ds distances between the 13 populations gave two major clades as shown in Figure 1. The first clade was composed of Myanmar and Indonesian native chicken populations. The second clade was composed of RJF and GJF, which was located outside the first clade.

Figure 1

Neighbor-joining (NJ) tree constructed by genetic distance matrix from 13 populations of native chickens and two jungle fowl species. Yan = Yangon; Peg = Pegu; Man = Mandalay; Sem = Semarang; Ken = Kendal; Yog = Yogyakarta; Kar = Karawang; AK-Tem = Ayam Kedu from Temmanggun; AK-Sol = Ayam Kedu from Solo; BK-Sem = Black Kedu from Semarang; AA-Tem = Ayam Alab from Temmanggun; RJF = Red jungle fowl; GJF = Green jungle fowl.

DISCUSSION

Indels polymorphisms

The results revealed both of the native chicken populations showed polymorphisms in most of the indels loci (greater than 90%). It is larger than the previous study of Väli et al. (2008) and their study stated that 81 and 76 out of 94 indels markers (86.2% and 80.9%) could be validated as polymorphic loci in dogs (n = 7) and wolves (n = 18). Jungle fowl populations especially in GJF showed much fewer polymorphic indels loci (4%) than native chicken populations. These results suggest that the indels polymorphisms examined here have been acquired in the chickens after the separation of ancestral species of the GJF and chickens.

Genetic variability

In this study, the H¯O and H¯E values were 0.206 to 0.268 and 0.229 to 0.284 in native chicken populations and 0.003 to 0.101 and 0.012 to 0.078 in two jungle fowl species respectively. The H¯E values of the present study were close to those of the gene constitution of blood groups in Myanmar and Indonesian native chickens (0.299 and 0.279) (Yamamoto et al., 2010). The H¯E values in the present study were higher when compared to the range of egg white protein polymorphisms estimated from native fowl populations in Asia ( H¯E = 0.089 to 0.170, Kinoshita et al., 2004) and blood protein variation in Myanmar native chicken ( H¯E = 0.198, Okamoto et al., 2004). However the H¯E values of the present study were lower than the heterozygosity of four calpain gene polymorphisms in Myanmar and Indonesian native chickens revealed 0.388 and 0.389 respectively (Okumura et al., 2006). These differences may have arisen from difference in the sample size, sample population and source of genetic markers in each study.

In the present study, the heterozygosities of native chickens were higher than the heterozygosities of ancestral species. This finding was similar to the earlier report of Väli et al. (2008). They reported that the values of H¯O and H¯E were 0.268 and 0.355 in dogs and 0.194 and 0.261 in wolf by using indels markers.

The Gst values of Myanmar and Indonesian native chicken populations were 0.041 and 0.098, indicating that the degree of genetic differentiation is higher in Indonesian native chicken than Myanmar native chicken. This might be related to the sample population of Indonesian native chicken, which contained local chicken varieties like BK, AA, and AK, and there may be some degree of genetic differentiation between them.

The Gst of present study was higher than those of Myanmar and Indonesian native chicken (0.024 and 0.020) estimated in the genetic constitution of four calpain gene polymorphisms (Okumura et al., 2006). However Gst of Myanmar native chicken was close to the range of 0.001 to 0.039 (Kinoshita et al., 2004) estimated from egg white protein polymorphism of local populations in Asian countries (Myanmar, Indonesia, China, Nepal, Vietnam and Laos). The Gst of Indonesian native chicken was close to blood protein polymorphisms found in four chicken breeds from Yunnan Province of China (Gst = 0.075, Okamoto et al., 2003) and Nepal (Gst = 0.093, Maeda et al., 1992).

The Gst between Myanmar and Indonesian native chickens was 0.119, indicating that the genetic differentiation between them was not large. Therefore, Myanmar and Indonesia native chickens can be regarded as genetically close populations. The Gst values between Myanmar native chicken populations and two jungle fowl species (0.213 to RJF and 0.264 to GJF) are greater than between Indonesian native chicken populations and two jungle fowl species (0.162 to RJF and 0.186 to GJF). It may be due to the fact that the small Gst was obtained between populations in a close geographic area. However, highest Gst (0.436) was observed between RJF and GJF from Java Island.

The Gst value in this study may be higher than the value of other studies. According to the review of Theresa et al. (2002), a wide range of Gst values usually results from uneven allele frequency distributions across populations at some loci. In the present study, the major allele was the same in all populations at 87 indels loci. Whereas uneven allele frequency distributions were observed in the remaining 15 loci: the major allele in most populations was minor in some populations, which may contribute to high Gst value.

Genetic distance and phylogenic analysis

The low genetic distance observed among native chicken populations (0.009 to 0.200), may be reflecting the fact that genetically these populations are not greatly isolated from each other. In addition, the average genetic distances among native chicken populations (0.088) observed in present study is close to the findings of Yamashita et al. (1994) by DNA fingerprinting analysis among the stock of domestic fowls (0.104). The larger genetic distances were found between native chicken populations and two jungle fowl species from Java Island.

The topology of the NJ tree showed that Myanmar native chickens and Indonesian native chickens form a respective cluster in one clade whereas RJF and GJF from Java Island formed another clade, suggesting that native chickens are genetically closely related to each other and remote from jungle fowls of Java Island.

In the previous studies of Yamashita et al. (1994) and Okumura et al. (2006), the GJF was located far away from native chicken populations and it is consistent with the hypothesis that domestication of the chicken may have started from RJF. However, RJF from Java Island comprises a different clade that was far away from native chicken populations, which agreed with the un-rooted neighbor joining (NJ) population tree of Niu et al. (2002). In their NJ tree, domestic fowls belonged to the same cluster as G. g. gallus and G. g. spadiceus in Thailand and its adjacent areas, whereas G. g. bankiva from Indonesian Islands formed a separate cluster. Furthermore Akishinonomiya et al. (1994) stated that the domestic fowl from Indonesian Island had large genetic differences compared with G.g.bankiva from the same region.

The present study examined the genetic characteristics of the Myanmar and Indonesia native chickens and two jungle fowl species from Java Island by using indels polymorphisms as genetic marker. The genetic variability is higher among native chicken populations and lower in the two jungle fowl species. The high genetic differentiation occurred between native chicken populations and two jungle fowl species from Java Island. The native chickens from two countries were genetically close to each other and remote from jungle fowls of Java Island. Although the indels markers showed low heterozygosity compared to microsatellite markers, they can demonstrate close genetic variability and phylogenic topology to other studies cited above. Therefore, indels polymorphisms are efficient for studying genetic diversity of populations.

References

Akishinnonomiya F, Miyake T, Sumi S, Takada M, Ohno S, Kondo N. 1994;One subspecies of the Red jungle fowl (Gallus gallus gallus) suffices as the matriarchic ancestor of all domestic breeds. Proc Natl Acad Sci USA 91:12505–12509.
Bambang S, Bustanul A. 2009;Overview on poultry sector and HPAI situation for Indonesia with special emphasis on the Island of Java. Background Paper, Africa/Indonesia Region Report 3:3–9.
Brandström M, Ellegren H. 2007;The genomic landscape of short insertion and deletion polymorphisms in the chicken (Gallus gallus) genome: A high frequency of deletions in tandem duplicates. Genetics 176:1691–1701.
Burgos S, Otte J, Holst DR. 2009;Poultry HPAI and livelihoods in Myanmar - A Review. Mekong Team Working Paper 8:23.
Kinoshita K, Ichiki T, Yamamoto Y, Tsunoda K, Okabayashi H, Mannen H, Tanaka K, Yamagata T, Nozawa K, Nishibori M, Kurosawa Y, Nyunt Maung Maung, Daing Than, Hla Than, Win Nay, Maeda Y. 2004;Gene constitution of egg white proteins of native chicken populations in Myanmar. Researches Report of the Society for Native Livestock 21:225–235.
Maeda Y, Yamamoto Y, Nishida T, Hashiguchi T, Okada I, Rajubhandary HB. 1992;Protein polymorphism in native and Red jungle fowls in Nepal. Asian-Aust. J AnimSci 5:747–752.
Mwacharo JM, Jianlin H, Amano T. 2006;Native African chicken: valuable genetic resources for future breeding improvement. J Anim Genet Jpn 34:63–69.
Niu D, Fu Y, Luo J, Ruan H, Yu XP, Chen G, Zhang YP. 2002;The origin and genetic diversity of Chinese native chicken breeds. BiochemGenet 40:163–174.
Nei M. 1972;Genetic distance between populations. Am Nat 106:283–292.
Nei M. 1973;Analysis of gene diversity in subdivided populations. Proc Nat Acad Sci USA 70:3321–3323.
Nei M. 1978;Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89:583–590.
Natalle SCF, Resque RL, Ribeiro-Rodrigues EM, Guerreiro JF, Santos NPC, Santos AR, Santos S. 2010;X-linked insertion/deletion polymorphisms: Forensic applications of a 33-markers panel. Int J Legal Med 124:589–593.
Okamoto S, Kinoshita K, Yamamoto Y, Tsunoda K, Okabayashi H, Mannen H, Tanaka K, Yamagata T, Nozawa K, Nishibori M, Kurosawa Y, Nyunt Maung Maung, Daing Than, Hla Than, Win Nay, Maeda Y. 2004;Blood protein variations of native fowls in Myanmar. Researches Report of the Society for Native Livestock 21:237–242.
Okamoto S, Keiichiro I, Zhu T, Maeda Y, Dexing H, Yang FT, Zhang HY, Wenbo XU, Liming S, Tsutomu H. 2003;Blood protein ploymorphisms in native chicken breeds in Yunnan Province of China. Anim Sci 74:471–476.
Okumura F, Shimogiri T, Kawabe K, Okamoto S, Nishibori M, Yamamoto Y, Maeda Y. 2006;Gene constitution of South-East Asian native chickens, commercial chickens and jungle fowl using polymorphisms of four Calpain genes. Anim Sci J 77:188–195.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: A laboratory manual, 2 2nd editionth ed. Cold Spring Laboratory Press. Cold Spring Harbor, New York, USA:
Saitou U, Nei M. 1987;The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406.
Tamura K, Dudley J, Nei M, Kumar S. 2007;MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Bio Evol 24:1596–1599.
Theresa MC, Lisa EW, Karla MG, Daniel JC. 2002;A comparison of two methods of calculating Gst, A genetic measure of population differentiation. Am J Bot 89:460–465.
Väli U, Brandström M, Johansson M, Ellegren H. 2008;Insertion-deletion polymorphisms (indels) as genetic markers in natural populations. BMC Genet 9:1–8.
Weir BS. 1996. Genetic data analysis II Sinauer. Sunderland, MA:
Wong GKS, Hillier L, Brandstrom M, Croojmans R, Ovcharenko I, Gordon L, Stubbs L, Lucas S, Glavina T, Kaiser P, Gunnarsson U, Webber C, Overton I. 2004;A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms. Nature 432:717–722.
Yamamoto Y, Ali A, Mohammad RA, Mohammad RM, Syed SH, Mohammad OF, Amano T. 2010;Composition of genes controlling blood groups and morpho-genetic traits of Bangladesh native chikens and its phylogenetic study. Researches Report of the Society for Native Livestock 25:131–146.
Yamashita H, Okamoto S, Maeda Y, Tsutomu H. 1994;Genetic relationships among domestic and jungle fowls revealed by DNA fingerprinting analysis. Jpn Poult Sci 31:335–344.

Article information Continued

Figure 1

Neighbor-joining (NJ) tree constructed by genetic distance matrix from 13 populations of native chickens and two jungle fowl species. Yan = Yangon; Peg = Pegu; Man = Mandalay; Sem = Semarang; Ken = Kendal; Yog = Yogyakarta; Kar = Karawang; AK-Tem = Ayam Kedu from Temmanggun; AK-Sol = Ayam Kedu from Solo; BK-Sem = Black Kedu from Semarang; AA-Tem = Ayam Alab from Temmanggun; RJF = Red jungle fowl; GJF = Green jungle fowl.

Table 1

Summary of primer sequences for 102 indels loci

Loci Chr: Reference NCBI Chromosomal position Forward primer (5’-3’) Reverse primer (3’-5’) Size range (bp) TA (°C) HWE (x2 value)
m 1 1: rs15186483 2380713 agctattcagggaggggatg ggatgcctgtttctggaaga 287–311 60 0.012
m 2 1: rs14796695 11865023 caggtagcttggggaatcag ttcttgtctgggccaaatgt 222–252 60 0.002
m 3 1: rs14803637 29610732 gggaaagataaaatggcttga cagatccacacttcagggaaa 263–292 60 0.028
m 4 1: rs15224689 32491050 aacccatgggggtcttgtat tagggaacagatggggaaaa 300–328 60 0.004
m 5 1: rs1524406 41678486 agcatcagcaaggtgctctt agacaaagcttccctggaca 272–299 60 0.023
m 6 1: rs15272331 56388055 gccccttcaagcatgatatt ctcctttcagctgcagatttc 297–321 60 0.017
m 7 1: rs13879446 67455476 agaatgccctttggattcct tcagcgggttatacagagca 265–295 60 0.113
m 8 1: rs14844703 73142545 aggcttacggttggagacaa aactgcaactccctccagtg 241–271 60 0.005
m 9 1: rs13893049 86184937 gagagctgggttctccagtg ttctttttgctggctgcttt 223–252 60 1×10−5
m 10 1: rs15340628 92114321 tgttttgccagcatgacatt gctgtgggagaaacaacaca 252–289 60 3×10−4
m 11 1: rs15354680 100316232 tgctcacagcaaacctaacg acgcaggctagaggacttca 265–288 60 0.353
m 12 1: rs15381205 112800871 tacagctcaggccacatgaa gggtccaaaagaaagacatca 270–297 60 0.001
m 13 1: rs15402998 123160898 ataacgcaaagggagggatg gtttgcctgtggtgttgtga 221–255 60 0.013
m 14 1: rs14888652 135638781 atgggctggtgaactgtagc ccatctggccttagcaaatc 349–374 60 0.001
m 15 1: rs15443072 143204968 gggaaactctgcattgctgt ataatgctgccactcctgct 298–329 60 1×10−5
m 16 1: rs15477016 159215305 gggatgagcttcaaagtgga acccaacaaggacgtgtca 268–296 60 0.051
m 17 1: rs15467491 162349692 cctccttgagctctgacacc tcctgtgggtcttttccaac 174–203 60 2.6×10−4
m 18 1: rs13968127 170697123 aacagaagcctcctgccttt aggatggtttggtttgcttg 276–304 60 0.183
m 19 1: rs13986305 186019671 aaaaagaagtgctgtctgaagaaaa gaaaacgcgaaatgaatggt 257–287 60 0.266
m 20 1: rs15550068 196892451 cagaccctacaagccacaca ttctcagaataattttgccagttg 301–324 60 0.001
m 21 1: rs15554369 200599560 tgacttccccattcattggt gcactttcacagcctcccta 300–326 60 0.010
m 22 2: rs15879191 7098042 attttgcttgacgtgcagtg ctgcagcctttgggagtatc 258–291 65 1.3×10−4
m 23 2: rs15891921 11463166 tcccttttcaggctgtgatt ctctaggccaagcatctggt 251–276 60 5.7×10−5
m 24 2: rs14151659 22996352 agggatatttgggacgaagg gccttttcacacatccaggt 298–329 60 0.055
m 25 2: rs15953427 37759827 tctatcaggccttgcacctt ttacttgagggtgcccaatc 254–282 60 0.011
m 26 2: rs15971881 44143530 tctctgcactctccaaagca tgtgagcaccgagcaataag 254–293 65 0.162
m 27 2: rs15102430 57732225 gtagaaggccaaccaaccaa caaccaaagagggaacatgc 253–279 65 n/a
m 28 2: rs16011387 61748980 tgcaagctcttgttcattgc ccgctttgctacatcctctc 261–291 65 0.019
m 29 2: rs16040761 78554543 tcagaaggatcgcatgaaga tcattttgagaaaagacaggaactt 235–262 55 0.106
m 30 2: rs16054197 87816451 aaccacattctggggatgaa aaccacctcccgtaacagtg 272–296 60 0.005
m 31 2: rs15132229 99174129 accagcccttaaaccgttg aatctcaaagcccacccagt 276–299 60 0.069
m 32 2: rs16088091 106532884 gcacagctatgcccaaaataa ctctgcctctggtggagact 276–299 60 0.005
m 33 2: rs14235853 116697385 catgcctgttgcttttacca ccttgttgaggcatgtcagt 257–277 65 0.001
m 34 2: rs15147812 123445602 cccctccaacctaagtcattc gtgcattccccatcatttct 285–314 60 0.002
m 35 2: rs14250138 131679775 ccagccctgtaggagagagtt agctgcaggacatgaggtct 229–255 60 0.001
m 36 2: rs15165839 145558702 aggcttgaggatacgcttca cagcccaacaggttaccataa 265–295 65 0.003
m 37 2: rs16144735 152495037 ctgccacagttcaagaagca ttccaagtaggcgaataccg 247–272 55 0.031
m 38 3: rs15267007 9421750 caaaatgtgcgacttttcct gaaactggccgtggtacaat 272–300 60 0.116
m 39 3: rs16229905 18459587 tgacagaatcaggggaaaatg gccttctatcaaagccagca 274–293 55 0.064
m 40 3: rs15299757 26141512 aagaaggagctaccgcactg actgcctggcaagtgaagat 236–261 55 n/a
m 41 3: rs16248030 32579565 ggtttccagcaacaggagaa ggatgagccaaaattggaga 261–286 55 0.008
m 42 3: rs15336669 44685823 ccaggttgtgtacgcagaga tttgccttccacgtttgtct 236–265 60 0.001
m 43 3: rs15364542 58211486 gccatttctgccactgtctt ggaaatggatcctgcaaaaa 337–360 60 n/a
m 44 3: rs15372369 65825652 gctttaaaagaagccgagca ccagaattcccaatttttcaa 297–326 60 0.069
m 45 3: rs15380325 70288536 aggatccttggtcaatgtgg cagttcaggcagatccatca 273–297 60 0.005
m 46 3: rs15409517 84493460 tccttctaagatgcggcaat cagtttggggttgggtaaaa 250–281 60 0.004
m 47 3: rs15427052 94441494 tgacaacgcatcacagcata gcttccgtattacccagcag 260–289 60 1.5×10−5
m 48 3: rs16338959 108511888 atattgggaactcgctgtgg atgtcacacaaagcctgctg 250–276 60 0.009
m 49 3: rs14413503 111873254 acatggcacttgatgaagca aattggcttttggacacctg 263–284 60 0.023
m 50 4: rs16359295 9542599 tataaatggggtgggtgtgg caccaaaagcagaaatgcaa 281–305 60 0.007
m 51 4: rs14432370 14488517 atttttgatctgggcacgaa gaggcaggaggtggaagag 227–252 60 0.001
m 52 4: rs14438548 24411304 aggcagacagatgtggaaga caggaatacaaagccgcagt 253–282 60 0.009
m 53 4: rs16384349 32708827 gcaaccctgaagaaaaccaa gcaaagcagagtttggaacc 258–287 60 0.004
m 54 4: rs16399900 46455122 ttgcagcaaaagggaagatt tggaggaatgcagctgacta 280–306 65 0.001
m 55 4: rs16414997 56511101 tctgtgcagattcggtatgg gtcactgcccttcagcaaat 243–272 60 0.009
m 56 4: rs16429149 68586191 catcagcttcccttttgtga tctcattgctcattgtacagctc 222–250 60 0.116
m 57 4: rs16431940 70693757 ttagcttcccccaaacactg aacagcggctcattcattct 289–314 60 0.001
m 58 4: rs16449188 89179812 agcatctcagccttccttca ctgggctcatacccatgtct 260–289 60 4.1×10−4
m 59 4: rs15642550 90357511 gctcatgcatggaatttgtg tcctgtgctctccatctatgc 264–290 60 0.017
m 60 5: rs14508864 1531872 tgtcacaaatgcaggaggtg cagacctcaaagcatcacaca 281–311 60 0.001
m 61 5: rs16463699 10884770 aggctccaagtgctgtgatt ccaaaataaagtcccgacaa 242–276 60 0.001
m 62 5: rs16478463 26549515 ccttgcatctcctccttcag ggagggaaagggtcaatgat 238–266 60 0.012
m 63 5: rs14529374 31922437 tggtcatgatggtttggaga gtgcaggacattttgcttga 268–297 60 0.001
m 64 5: rs14542642 48345965 tcctaatgtcggtcatgctg caagtctgtggccaggaagt 270–299 60 0.006
m 65 5: rs16508335 51981730 ggcagaggagagcagaaatg tgctgtttgtccgaagtttg 261–291 60 0.017
m 66 5: rs15745605 60173479 ccacccgagtcctaagtctg tcttcatggggaaggaagtg 242–271 60 2.5×10−7
m 67 6: rs14570404 9359709 gctgttcacttggtcttgc cgaggactgaaggaaatgaca 326–349 60 0.023
m 68 6: rs14580218 19952173 gctctgcttccctcctttct ttgtgatccacacctgcatt 279–305 60 0.001
m 69 6: rs15811157 29943028 ttttgttaaccaggggcaat gtagcatctgcagcccaaat 334–363 60 0.004
m 70 6: rs15823004 36962704 tgcctcagtctggtctgttg tgcatgagggttcagaagtg 279–308 60 0.003
m 71 7: rs14604441 7009917 agcatcacaccaactgcaag cattcctccagagcttcctc 294–314 60 0.006
m 72 7: rs16591682 18682408 gctgctataagctgcccatc ggcaagcaggaaatgaagag 284–306 60 1.5×10−4
m 73 7: rs14622212 29604888 ttaaagccagcacacaatgc catccagcagtcagcctttt 331–360 60 3.8×10−4
m 74 7: rs16615778 37651290 gaggatatgggcaagtctgg tccccttgtcctgctgttat 324–350 60 0.026
m 75 8: rs15908922 9253123 ttttcatgggtagttcattagaga atgctgccttccataactgc 307–327 60 0.004
m 76 8: rs16636129 19782818 gcgtcagagtgtgaaatgct agcacgctgttcctctgaat 302–324 60 0.128
m 77 8: rs16649376 29327443 catttggggcagcagtattc cacctcccaaacttgcatct 339–363 60 0.0159
m 78 9: rs16664917 4736922 tcctcctggaacttcctcct ttcagtttgccttggtcctc 320–345 60 0.0123
m 79 9: rs14683671 24883034 gtcgcagcttcagaaaggac ctgtacacaaacggcgatgt 286–311 60 0.148
m 80 9: rs14672349 13452188 attgaaagcgaccattccag gccttctgaaacctaccaagtt 277–302 60 0.001
m 81 10: rs15572293 8045518 tgcacaaaactaatcttgctgtct ggtgttgtcaatcctgtttgc 309–330 60 0.021
m 82 10: rs14012832 20119574 ggccaggatctcaaaacaga tccccttgtatgtcctctgc 319–346 60 0.003
m 83 11: rs15611781 9281820 ctgcctccaggcctttctat gcacaagaatcaccagcaag 319–348 60 0.001
m 84 11: rs14018578 1883678 ccagggctatggaatgctta cactggctgactgcagatgt 319–347 60 1.3×10−5
m 85 11: rs14693330 20791178 tttgagcaccaccgtgagta cccagctcaagagtcgaaac 290–315 60 0.045
m 86 12: rs15648972 9133627 cggtcctcatgttgtcaaag gacaatgcacagctgcataaa 305–327 62 0.001
m 87 12: rs15672210 19136567 aagggcagagaactgttcca tgggttggagggtatcttca 334–364 60 0.024
m 88 13: rs15695194 9834883 ggtgggtaatccagtctctcc cttcaggctcaacaggaacc 293–326 60 0.002
m 89 13: rs15706498 15621848 agcgcacacatttgcattag aggctgaggaaggttgtcct 299–325 60 0.031
m 90 14: rs14077825 9856807 tgtttggcatacctgtgcat taggaagaaagggctctgct 315–336 60 0.213
m 91 14: rs15740439 11675614 aggcatgccagaacattcat ggtcttttccagcctgagtg 278–301 60 0.215
m 92 15: rs14094135 9649390 tagttcccagtggtgtgtgg agggtgtctcttcagcctca 310–334 60 0.001
m 93 15: rs15783434 10844586 taattgattcagcgcagagc ccagccagcttcattgagat 291–315 60 0.005
m 94 16: rs15026709 133330 actcattgggaatggactcg cacgtccctctccatgtttt 331–346 60 0.005
m 95 17: rs15790503 9512181 ctcagcccttgctttctttg ttggattctccctcatttgc 282–311 48 n/a
m 96 17: rs15027282 10043385 ccacaacgactcggttaagaa gtcattgctgggaacctcat 287–315 60 0.203
m 97 18: rs15818344 3551368 ttcagttttggtgtcgctca ttctctgagcctgccagaat 300–323 60 0.029
m 98 19: rs14121581 6252496 cgccacacataaatcagtcg ccttgttgctacctggctgt 349–376 60 n/a
m 99 20: rs14277689 9478707 cgaggatgacctgtggtgta tcctgaaagcttttgtgtgc 326–355 65 0.004
m 100 20: rs16174629 11941342 accatgggctgttctttgaa ggcaggttgtgaaggatagc 323–347 65 0.004
m 101 21: rs16179814 3159840 acaaccgctcgacagaaagt agttgacctcccctggaaat 284–310 65 5.8×10−5
m 102 22: rs16183765 3842053 tcagggacatcccagaagac gcaccagaaatgctctctcc 339–368 65 0.046

HWE-Hardy-Weinberg Equilibrium Test (n/a = Not applicable; the rest of the markers are non significant at p<0.05).

Table 2

The genetic variability from 13 populations of native chickens and two jungle fowl species

Population No. of samples PPoly ±SE H¯O ±SE H¯E ±SE
Yan 27 0.901 0.034 0.216 0.004 0.266 0.004
Peg 13 0.713 0.045 0.218 0.005 0.239 0.004
Man 40 0.871 0.034 0.229 0.005 0.263 0.005
Sem 24 0.861 0.035 0.258 0.004 0.269 0.004
Ken 40 0.901 0.029 0.242 0.004 0.276 0.004
Yog 57 0.901 0.029 0.268 0.005 0.284 0.004
Kar 15 0.792 0.041 0.231 0.004 0.263 0.004
AK-Tem 10 0.772 0.041 0.239 0.005 0.255 0.004
AK-Sol 19 0.881 0.032 0.250 0.004 0.278 0.004
BK-Sem 23 0.743 0.044 0.207 0.004 0.242 0.004
AA-Tem 20 0.812 0.039 0.206 0.004 0.229 0.004
RJF 3 0.218 0.041 0.101 0.005 0.078 0.004
GJF 6 0.039 0.019 0.003 0.002 0.012 0.003

Yan = Yangon; Peg = Pegu; Man = Mandalay; Sem = Semarang; Ken = Kendal; Yog = Yogyakarta; Kar = Karawang; AK-Tem = Ayam Kedu from Temmanggun; AK-Sol = Ayam Kedu from Solo; BK-Sem = Black Kedu from Semarang; AA-Tem = Ayam Alab from Temmanggun; RJF = Red jungle fowl; GJF = Green jungle fowl.

Table 3

Coefficient of genetic differentiation (Gst) in various subsets of 13 populations of native chickens and two jungle fowl species estimated from 102 indels loci

Subset Gst
Among Myanmar native chickens 0.041
Among Indonesia native chickens 0.098
Among Myanmar and Indonesia native chickens 0.119
Between 2 jungle fowl species 0.436
Between Myanmar native chicken and RJF 0.213
Between Myanmar native chicken and GJF 0.264
Between Indonesia native chicken and RJF 0.162
Between Indonesia native chicken and GJF 0.186
Among 13 subpopulations 0.227

RJF = Red jungle fowl; GJF = Green jungle fowl.

Table 4

Pair wise genetic distance matrix between 13 populations of native chickens and two jungle fowl species

Yan Peg Man Sem Ken Yog Kar AK-Tem AK-Sol BK-Sem AATem RJF GJF
Yan 0.078 0.034 0.082 0.063 0.063 0.099 0.087 0.072 0.139 0.102 0.405 0.367
Peg 0.062 0.156 0.133 0.136 0.146 0.165 0.143 0.200 0.150 0.342 0.333
Man 0.093 0.065 0.067 0.110 0.088 0.075 0.174 0.118 0.337 0.347
Sem 0.040 0.049 0.088 0.048 0.054 0.129 0.057 0.326 0.344
Ken 0.012 0.046 0.017 0.009 0.092 0.086 0.288 0.289
Yog 0.055 0.026 0.019 0.103 0.089 0.287 0.294
Kar 0.076 0.049 0.093 0.124 0.282 0.247
AK-Tem 0.023 0.114 0.093 0.308 0.337
AK-Sol 0.100 0.099 0.318 0.335
BK-Sem 0.147 0.304 0.263
AA-Tem 0.342 0.334
RJF 0.251
GJF

Yan = Yangon; Peg = Pegu; Man = Mandalay; Sem = Semarang; Ken = Kendal; Yog = Yogyakarta; Kar = Karawang; AK-Tem = Ayam Kedu from Temmanggun; AK-Sol = Ayam Kedu from Solo; BK-Semarang = Black Kedu from Semarang; AA-Tem = Ayam Alab from Temmanggun; RJF = Red jungle Fowl; GJF = Green jungle Fowl.